c-MET cDNA ORF Clone, Human, untagged

Cat: HG10692-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All c-MET Reagents
CRO Services
Product recommended

All c-MET Reagents
c-MET cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
4173 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human met proto-oncogene (hepatocyte growth factor receptor) transcript variant 2.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + NotI(6.1kb+4.17kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
c-MET cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

c-MET cDNA ORF Clone, Human, untagged Validated Images
Human IL12A / IL-12A Gene Plasmid Map 5647
c-MET cDNA ORF Clone, Human, untagged Alternative Names
AUTS9 cDNA ORF Clone, Human;c-Met cDNA ORF Clone, Human;DFNB97 cDNA ORF Clone, Human;HGFR cDNA ORF Clone, Human;RCCP2 cDNA ORF Clone, Human
c-MET Background Information

Hepatocyte growth factor receptor (HGFR), also known as c-Met or mesenchymal-epithelial transition factor (MET), is a receptor tyrosine kinase (RTK) that has been shown to be overexpressed and/or mutated in a variety of malignancies. HGFR protein is produced as a single-chain precursor, and HGF is the only known ligand. Normal HGF/HGFR signaling is essential for embryonic development, tissue repair or wound healing, whereas aberrantly active HGFR has been strongly implicated in tumorigenesis, particularly in the development of invasive and metastatic phenotypes. HGFR protein is a multifaceted regulator of growth, motility, and invasion, and is normally expressed by cells of epithelial origin. Preclinical studies suggest that targeting aberrant HGFR signaling could be an attractive therapy in cancer.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
MET proto-oncogene, receptor tyrosine kinase
References
  • McGill GG, et al. (2006) c-Met expression is regulated by Mitf in the melanocyte lineage. J Biol Chem. 281(15): 10365-73.
  • Garcia S, et al. (2007) c-Met overexpression in inflammatory breast carcinomas: automated quantification on tissue microarrays. British journal of cancer. 96(2): 329-35.
  • Socoteanu MP, et al. (2008) c-Met targeted therapy of cholangiocarcinoma. World J Gastroenterol. 14(19): 2990-4.
  • Kong DS, et al. (2009) Prognostic significance of c-Met expression in glioblastomas. Cancer. 115(1): 140-8.
  • c-MET cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    c-MET cDNA ORF Clone in Cloning Vector, Rhesus CG90304-G
    c-MET cDNA ORF Clone, Rhesus, untagged CG90304-UT
    c-MET cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90304-ACG
    c-MET Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90304-ACGLN
    c-MET cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90304-ACR
    c-MET cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90304-CF
    c-MET cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90304-NF
    c-MET cDNA ORF Clone, Rhesus, C-His tag CG90304-CH
    c-MET cDNA ORF Clone, Rhesus, N-His tag CG90304-NH
    c-MET cDNA ORF Clone, Rhesus, C-HA tag CG90304-CY
    c-MET cDNA ORF Clone, Rhesus, N-HA tag CG90304-NY
    c-MET cDNA ORF Clone, Rhesus, C-Myc tag CG90304-CM
    c-MET cDNA ORF Clone, Rhesus, N-Myc tag CG90304-NM

    c-MET cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    c-MET cDNA ORF Clone in Cloning Vector, Rat RG80004-M
    c-MET cDNA ORF Clone, Rat, untagged RG80004-UT
    c-MET cDNA ORF Clone, Rat, C-GFPSpark® tag RG80004-ACG
    c-MET Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80004-ACGLN
    c-MET cDNA ORF Clone, Rat, C-OFPSpark® tag RG80004-ACR
    c-MET cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80004-CF
    c-MET cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80004-NF
    c-MET cDNA ORF Clone, Rat, C-His tag RG80004-CH
    c-MET cDNA ORF Clone, Rat, N-His tag RG80004-NH
    c-MET cDNA ORF Clone, Rat, C-HA tag RG80004-CY
    c-MET cDNA ORF Clone, Rat, N-HA tag RG80004-NY
    c-MET cDNA ORF Clone, Rat, C-Myc tag RG80004-CM
    c-MET cDNA ORF Clone, Rat, N-Myc tag RG80004-NM
    c-MET qPCR Primer Pairs, Rat RP300004

    c-MET cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    c-MET cDNA ORF Clone in Cloning Vector, Mouse MG50622-M
    c-MET cDNA ORF Clone, Mouse, untagged MG50622-UT
    c-MET Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50622-ACGLN
    c-MET cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50622-ACG
    c-MET cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50622-ACR
    c-MET cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50622-CF
    c-MET cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50622-NF
    c-MET cDNA ORF Clone, Mouse, C-His tag MG50622-CH
    c-MET cDNA ORF Clone, Mouse, N-His tag MG50622-NH
    c-MET cDNA ORF Clone, Mouse, C-HA tag MG50622-CY
    c-MET cDNA ORF Clone, Mouse, N-HA tag MG50622-NY
    c-MET cDNA ORF Clone, Mouse, C-Myc tag MG50622-CM
    c-MET cDNA ORF Clone, Mouse, N-Myc tag MG50622-NM
    c-MET qPCR Primer Pairs, Mouse MP200607

    c-MET cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    c-MET cDNA ORF Clone in Cloning Vector, Human HG10692-M
    c-MET cDNA ORF Clone, Human, C-GFPSpark® tag HG10692-ACG
    c-MET Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10692-ACGLN
    c-MET cDNA ORF Clone, Human, C-OFPSpark® tag HG10692-ACR
    c-MET cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10692-CF
    c-MET cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10692-NF
    c-MET cDNA ORF Clone, Human, C-His tag HG10692-CH
    c-MET cDNA ORF Clone, Human, N-His tag HG10692-NH
    c-MET cDNA ORF Clone, Human, C-HA tag HG10692-CY
    c-MET cDNA ORF Clone, Human, N-HA tag HG10692-NY
    c-MET cDNA ORF Clone, Human, C-Myc tag HG10692-CM
    c-MET cDNA ORF Clone, Human, N-Myc tag HG10692-NM
    c-MET qPCR Primer Pairs, Human HP100082
    info info
    添加购物车成功! 添加购物车失败!