Quick Order

Human c-Met/Met/HGFR transcript variant 2 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human MET cDNA Clone Product Information
NCBI RefSeq:NM_000245.2
RefSeq ORF Size:4173bp
cDNA Description:Full length Clone DNA of Homo sapiens met proto-oncogene (hepatocyte growth factor receptor) transcript variant 2.
Gene Synonym:HGFR, AUTS9, RCCP2, c-Met
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Hepatocyte growth factor receptor (HGFR), also known as c-Met or mesenchymal-epithelial transition factor (MET), is a receptor tyrosine kinase (RTK) that has been shown to be overexpressed and/or mutated in a variety of malignancies. HGFR protein is produced as a single-chain precursor, and HGF is the only known ligand. Normal HGF/HGFR signaling is essential for embryonic development, tissue repair or wound healing, whereas aberrantly active HGFR has been strongly implicated in tumorigenesis, particularly in the development of invasive and metastatic phenotypes. HGFR protein is a multifaceted regulator of growth, motility, and invasion, and is normally expressed by cells of epithelial origin. Preclinical studies suggest that targeting aberrant HGFR signaling could be an attractive therapy in cancer.

References
  • McGill GG, et al. (2006) c-Met expression is regulated by Mitf in the melanocyte lineage. J Biol Chem. 281(15): 10365-73.
  • Garcia S, et al. (2007) c-Met overexpression in inflammatory breast carcinomas: automated quantification on tissue microarrays. British journal of cancer. 96(2): 329-35.
  • Socoteanu MP, et al. (2008) c-Met targeted therapy of cholangiocarcinoma. World J Gastroenterol. 14(19): 2990-4.
  • Kong DS, et al. (2009) Prognostic significance of c-Met expression in glioblastomas. Cancer. 115(1): 140-8.
  • Size / Price
    Catalog: HG10692-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability4-5 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"