HEXA cDNA ORF Clone, Human, C-His tag

Cat: HG12037-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All HEXA Reagents

CRO Services

Product recommended


All HEXA Reagents

HEXA cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1635 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1518A/G not causing the amino acid variation.
Description
Full length Clone DNA of Human hexosaminidase A (alpha polypeptide) with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
HindIII + XbaI(6kb+1.64kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

HEXA cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HEXA cDNA ORF Clone, Human, C-His tag Validated Images

Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5620

HEXA cDNA ORF Clone, Human, C-His tag Alternative Names

TSD cDNA ORF Clone, Human

HEXA Background Information

Full Name
hexosaminidase A (alpha polypeptide)
References
  • Norflus,F. et al., 1996, DNA Cell Biol. 15 (2):89-97.
  • Kaufman M., et al., 1997, Hum. Mutat. 10:295-300.
  • Tanaka A., et al., 2003, J. Hum. Genet. 48:571-574.
  • Chen R., et al., 2009, J. Proteome Res. 8:651-661.
  • Burkard T.R., et al., 2011, BMC Syst. Biol. 5:17-17.
  • HEXA cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    HEXA cDNA ORF Clone in Cloning Vector, Mouse MG53109-G
    HEXA cDNA ORF Clone, Mouse, untagged MG53109-UT
    HEXA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53109-ACGLN
    HEXA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53109-ACG
    HEXA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53109-ACR
    HEXA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53109-CF
    HEXA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53109-NF
    HEXA cDNA ORF Clone, Mouse, C-His tag MG53109-CH
    HEXA cDNA ORF Clone, Mouse, N-His tag MG53109-NH
    HEXA cDNA ORF Clone, Mouse, C-HA tag MG53109-CY
    HEXA cDNA ORF Clone, Mouse, N-HA tag MG53109-NY
    HEXA cDNA ORF Clone, Mouse, C-Myc tag MG53109-CM
    HEXA cDNA ORF Clone, Mouse, N-Myc tag MG53109-NM

    HEXA cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    HEXA cDNA ORF Clone in Cloning Vector, Human HG12037-G
    HEXA cDNA ORF Clone, Human, untagged HG12037-UT
    HEXA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12037-ACGLN
    HEXA cDNA ORF Clone, Human, C-GFPSpark® tag HG12037-ACG
    HEXA cDNA ORF Clone, Human, C-OFPSpark® tag HG12037-ACR
    HEXA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12037-CF
    HEXA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12037-NF
    HEXA cDNA ORF Clone, Human, N-His tag HG12037-NH
    HEXA cDNA ORF Clone, Human, C-HA tag HG12037-CY
    HEXA cDNA ORF Clone, Human, N-HA tag HG12037-NY
    HEXA cDNA ORF Clone, Human, C-Myc tag HG12037-CM
    HEXA cDNA ORF Clone, Human, N-Myc tag HG12037-NM
    HEXA qPCR Primer Pairs, Human HP101571
    info info
    添加购物车成功! 添加购物车失败!