Quick Order

Human HEXA Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human HEXA cDNA Clone Product Information
NCBI RefSeq:NM_000520
RefSeq ORF Size:1590bp
cDNA Description:Full length Clone DNA of Homo sapiens hexosaminidase A (alpha polypeptide).
Gene Synonym:HEXA
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Norflus,F. et al., 1996, DNA Cell Biol. 15 (2):89-97.
  • Kaufman M., et al., 1997, Hum. Mutat. 10:295-300.
  • Tanaka A., et al., 2003, J. Hum. Genet. 48:571-574.
  • Chen R., et al., 2009, J. Proteome Res. 8:651-661.
  • Burkard T.R., et al., 2011, BMC Syst. Biol. 5:17-17.
  • Size / Price
    Catalog: HG12037-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"