HDGFRP3 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG11357-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All HDGFRP3 Reagents
CRO Services
Product recommended

All HDGFRP3 Reagents
HDGFRP3 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
612 bp
Description
Full length Clone DNA of Human hepatoma-derived growth factor, related protein 3 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HDGFRP3 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
CGI-142 cDNA ORF Clone, Human;HDGF-2 cDNA ORF Clone, Human;HDGF2 cDNA ORF Clone, Human;HRP-3 cDNA ORF Clone, Human
HDGFRP3 Background Information
Full Name
hepatoma-derived growth factor, related protein 3

HDGFRP3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HDGFRP3 cDNA ORF Clone in Cloning Vector, Rat RG81637-G
HDGFRP3 cDNA ORF Clone, Rat, untagged RG81637-UT
HDGFRP3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81637-ACG
HDGFRP3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81637-ACGLN
HDGFRP3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81637-ANG
HDGFRP3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81637-ACR
HDGFRP3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81637-ANR
HDGFRP3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81637-CF
HDGFRP3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81637-NF
HDGFRP3 cDNA ORF Clone, Rat, C-His tag RG81637-CH
HDGFRP3 cDNA ORF Clone, Rat, N-His tag RG81637-NH
HDGFRP3 cDNA ORF Clone, Rat, C-HA tag RG81637-CY
HDGFRP3 cDNA ORF Clone, Rat, N-HA tag RG81637-NY
HDGFRP3 cDNA ORF Clone, Rat, C-Myc tag RG81637-CM
HDGFRP3 cDNA ORF Clone, Rat, N-Myc tag RG81637-NM

HDGFRP3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HDGFRP3 cDNA ORF Clone in Cloning Vector, Mouse MG51596-G
HDGFRP3 cDNA ORF Clone, Mouse, untagged MG51596-UT
HDGFRP3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51596-ACG
HDGFRP3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51596-ACGLN
HDGFRP3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51596-ANG
HDGFRP3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51596-ACR
HDGFRP3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51596-ANR
HDGFRP3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51596-CF
HDGFRP3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51596-NF
HDGFRP3 cDNA ORF Clone, Mouse, C-His tag MG51596-CH
HDGFRP3 cDNA ORF Clone, Mouse, N-His tag MG51596-NH
HDGFRP3 cDNA ORF Clone, Mouse, C-HA tag MG51596-CY
HDGFRP3 cDNA ORF Clone, Mouse, N-HA tag MG51596-NY
HDGFRP3 cDNA ORF Clone, Mouse, C-Myc tag MG51596-CM
HDGFRP3 cDNA ORF Clone, Mouse, N-Myc tag MG51596-NM
HDGFRP3 qPCR Primer Pairs, Mouse MP201479

HDGFRP3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HDGFRP3 cDNA ORF Clone in Cloning Vector, Human HG11357-M
HDGFRP3 cDNA ORF Clone, Human, untagged HG11357-UT
HDGFRP3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11357-ACGLN
HDGFRP3 cDNA ORF Clone, Human, C-GFPSpark® tag HG11357-ACG
HDGFRP3 cDNA ORF Clone, Human, N-GFPSpark® tag HG11357-ANG
HDGFRP3 cDNA ORF Clone, Human, C-OFPSpark® tag HG11357-ACR
HDGFRP3 cDNA ORF Clone, Human, N-OFPSpark® tag HG11357-ANR
HDGFRP3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11357-CF
HDGFRP3 cDNA ORF Clone, Human, C-His tag HG11357-CH
HDGFRP3 cDNA ORF Clone, Human, N-His tag HG11357-NH
HDGFRP3 cDNA ORF Clone, Human, C-HA tag HG11357-CY
HDGFRP3 cDNA ORF Clone, Human, N-HA tag HG11357-NY
HDGFRP3 cDNA ORF Clone, Human, C-Myc tag HG11357-CM
HDGFRP3 cDNA ORF Clone, Human, N-Myc tag HG11357-NM
HDGFRP3 qPCR Primer Pairs, Human HP101242
info info
添加购物车成功! 添加购物车失败!