HDAC3 cDNA ORF Clone, Human, N-Myc tag

Cat: HG11511-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All HDAC3 Reagents
CRO Services
Product recommended

All HDAC3 Reagents
HDAC3 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1287 bp
Description
Full length Clone DNA of Human histone deacetylase 3 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HDAC3 cDNA ORF Clone, Human, N-Myc tag Alternative Names
HD3 cDNA ORF Clone, Human;RPD3 cDNA ORF Clone, Human;RPD3-2 cDNA ORF Clone, Human
HDAC3 Background Information

Histone Deacetylases (HDACs) are a group of enzymes closely related to sirtuins. They catalyze the removal of acetyl groups from lysine residues in histones and non-histone proteins, resulting in transcriptional repression. In general, they do not act autonomously but as components of large multiprotein complexes, such as pRb-E2F and mSin3A, that mediate important transcription regulatory pathways. There are three classes of HDACs; classes 1, 2 and 4, which are closely related Zn2+-dependent enzymes. HDACs are ubiquitously expressed and they can exist in the nucleus or cytosol. Their subcellular localization is effected by protein-protein interactions (for example HDAC-14.3.3 complexes are retained in the cytosol) and by the class to which they belong (class 1 HDACs are predominantly nuclear whilst class 2 HDACs shuttle between the nucleus and cytosol). HDACs have a role in cell growth arrest, differentiation and death and this has led to substantial interest in HDAC inhibitors as possible antineoplastic agents. Histone Deacetylases (HDACs) is Responsible for the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2, H3 and H4). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events. Histone deacetylases act via the formation of large multiprotein complexes. Probably participates in the regulation of transcription through its binding to the zinc-finger transcription factor YY1; increases YY1 repression activity. Required to repress transcription of the POU1F1 transcription factor. Acts as a molecular chaperone for shuttling phosphorylated NR2C1 to PML bodies for sumoylation.

Full Name
histone deacetylase 3
References
  • Emiliani S, et al. (1998) Characterization of a human RPD3 ortholog, HDAC3. Proc Natl Acad Sci. 95 (6): 2795-800.
  • Dangond F, et al. (1998) Differential display cloning of a novel human histone deacetylase (HDAC3) cDNA from PHA-activated immune cells. Biochem Biophys Res Commun. 242 (3): 648-52.
  • Nicolas E, et al. (2001) The histone deacetylase HDAC3 targets RbAp48 to the retinoblastoma protein. Nucleic Acids Res. 29 (15): 3131-6.
  • HDAC3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    HDAC3 cDNA ORF Clone in Cloning Vector, Mouse MG53292-U
    HDAC3 cDNA ORF Clone, Mouse, untagged MG53292-UT
    HDAC3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53292-ACG
    HDAC3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53292-ACGLN
    HDAC3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53292-ANG
    HDAC3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53292-ACR
    HDAC3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53292-ANR
    HDAC3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53292-CF
    HDAC3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53292-NF
    HDAC3 cDNA ORF Clone, Mouse, C-His tag MG53292-CH
    HDAC3 cDNA ORF Clone, Mouse, N-His tag MG53292-NH
    HDAC3 cDNA ORF Clone, Mouse, C-HA tag MG53292-CY
    HDAC3 cDNA ORF Clone, Mouse, N-HA tag MG53292-NY
    HDAC3 cDNA ORF Clone, Mouse, C-Myc tag MG53292-CM
    HDAC3 cDNA ORF Clone, Mouse, N-Myc tag MG53292-NM

    HDAC3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    HDAC3 cDNA ORF Clone in Cloning Vector, Human HG11511-M
    HDAC3 cDNA ORF Clone, Human, untagged HG11511-UT
    HDAC3 cDNA ORF Clone, Human, C-GFPSpark® tag HG11511-ACG
    HDAC3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11511-ACGLN
    HDAC3 cDNA ORF Clone, Human, N-GFPSpark® tag HG11511-ANG
    HDAC3 cDNA ORF Clone, Human, C-OFPSpark® tag HG11511-ACR
    HDAC3 cDNA ORF Clone, Human, N-OFPSpark® tag HG11511-ANR
    HDAC3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11511-CF
    HDAC3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11511-NF
    HDAC3 cDNA ORF Clone, Human, C-His tag HG11511-CH
    HDAC3 cDNA ORF Clone, Human, N-His tag HG11511-NH
    HDAC3 cDNA ORF Clone, Human, C-HA tag HG11511-CY
    HDAC3 cDNA ORF Clone, Human, N-HA tag HG11511-NY
    HDAC3 cDNA ORF Clone, Human, C-Myc tag HG11511-CM
    HDAC3 qPCR Primer Pairs, Human HP101382
    info info
    添加购物车成功! 添加购物车失败!