HDAC1 cDNA ORF Clone, Human, N-His tag

Cat: HG11486-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HDAC1 Reagents
CRO Services
Product recommended

All HDAC1 Reagents
HDAC1 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1449 bp
Description
Full length Clone DNA of Human histone deacetylase 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HDAC1 cDNA ORF Clone, Human, N-His tag Alternative Names
GON-10 cDNA ORF Clone, Human;HD1 cDNA ORF Clone, Human;RPD3 cDNA ORF Clone, Human;RPD3L1 cDNA ORF Clone, Human
HDAC1 Background Information

Histone acetylation and deacetylation, catalyzed by multisubunit complexes, play a key role in the regulation of eukaryotic gene expression. Histone Deacetylase 1 protein encoded by this gene belongs to the histone deacetylase/acuc/apha family and is a component of the histone deacetylase complex. It also interacts with retinoblastoma tumor-suppressor protein and this complex is a key element in the control of cell proliferation and differentiation. Together with metastasis-associated protein-2, it deacetylates p53 and modulates its effect on cell growth and apoptosis.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
histone deacetylase 1
References
  • Beharry AW, Sandesara PB, Roberts BM, Ferreira LF, Senf SM, Judge AR. HDAC1 activates FoxO and is both sufficient and required for skeletal muscle atrophy. Journal of Cell Science. 2014;127(7):1441-1453.
  • HDAC1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    HDAC1 cDNA ORF Clone in Cloning Vector, Mouse MG53562-G
    HDAC1 cDNA ORF Clone, Mouse, untagged MG53562-UT
    HDAC1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53562-ACG
    HDAC1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53562-ACGLN
    HDAC1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53562-ANG
    HDAC1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53562-ACR
    HDAC1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53562-ANR
    HDAC1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53562-CF
    HDAC1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53562-NF
    HDAC1 cDNA ORF Clone, Mouse, C-His tag MG53562-CH
    HDAC1 cDNA ORF Clone, Mouse, N-His tag MG53562-NH
    HDAC1 cDNA ORF Clone, Mouse, C-HA tag MG53562-CY
    HDAC1 cDNA ORF Clone, Mouse, N-HA tag MG53562-NY
    HDAC1 cDNA ORF Clone, Mouse, C-Myc tag MG53562-CM
    HDAC1 cDNA ORF Clone, Mouse, N-Myc tag MG53562-NM

    HDAC1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    HDAC1 cDNA ORF Clone in Cloning Vector, Human HG11486-M
    HDAC1 cDNA ORF Clone, Human, untagged HG11486-UT
    HDAC1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11486-ACG
    HDAC1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11486-ACGLN
    HDAC1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11486-ANG
    HDAC1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11486-ACR
    HDAC1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11486-ANR
    HDAC1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11486-CF
    HDAC1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11486-NF
    HDAC1 cDNA ORF Clone, Human, C-His tag HG11486-CH
    HDAC1 cDNA ORF Clone, Human, C-HA tag HG11486-CY
    HDAC1 cDNA ORF Clone, Human, N-HA tag HG11486-NY
    HDAC1 cDNA ORF Clone, Human, C-Myc tag HG11486-CM
    HDAC1 cDNA ORF Clone, Human, N-Myc tag HG11486-NM
    HDAC1 qPCR Primer Pairs, Human HP101362
    info info
    添加购物车成功! 添加购物车失败!