Quick Order

Human HCST / DAP10 Gene ORF cDNA clone expression plasmid, N-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Human HCST cDNA Clone Product Information
    NCBI RefSeq:BC035931
    RefSeq ORF Size:282bp
    cDNA Description:Full length Clone DNA of Homo sapiens hematopoietic cell signal transducer with N terminal HA tag.
    Gene Synonym:DAP10, KAP10, PIK3AP
    Species:Human
    Vector:pCMV3-SP-N-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with HCST qPCR primers for gene expression analysis, HP102719 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    HCST, also known as DAP10, belongs to the DAP10 family. It is a transmembrane signaling adaptor that contains a YxxM motif in its cytoplasmic domain. HCST may be part of the immune recognition receptor complex. This receptor plays a major role in triggering cytotoxicity against target cells expressing cell surface ligands such as MHC class I chain-related MICA and MICB, and UL16-binding proteins (ULBPs). It may activate phosphatidylinositol 3-kinase dependent signaling pathways through its intracytoplasmic YxxM motif.

    References
  • Wu J. et al., 1999, Science. 285 (5428): 730-2.
  • Karimi M. et al., 2006, J Immunol. 175 (12): 7819-28.
  • André P. et al., 2004, Eur J Immunol. 34 (4): 961-71.
  • Size / Price
    Catalog: HG14063-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"