HBP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG14127-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All HBP1 Reagents
CRO Services
Product recommended

All HBP1 Reagents
HBP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1545 bp
Description
Full length Clone DNA of Human HMG-box transcription factor 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HBP1 Background Information

HBP1 is a sequence-specific DNA-binding transcription factor. It is involved in many biological processes. It was reported that HBP1 binds to p16(INK4A) promoter and activates p16(INK4A) expression. We found that trichostatin A (TSA), an inhibitor of HDAC (histone deacetylase), induces p16(INK4A) expression in an HBP1-dependent manner. HBP1 activates or represses the expression of some specific genes during cell growth and differentiation. HBP1 was acetylated by p300/CBP in two regions: repression domain (K297/305/307) and P domain (K171/419). HBP1 acetylation after TSA treatment was confirmed by immunoprecipitation assay. HBP1 interacted with histone acetyltransferase p300 and CREB-binding protein (CBP) and also recruited p300/CBP to p16(INK4A) promoter. HBP1 acetylation at K419 plays an important role in HBP1-induced p16(INK4A) expression.

Full Name
HMG-box transcription factor 1
References
  • Tevosian SG. et al., 1997, Genes Dev. 11 (3): 383-96.
  • Lavender P. et al., 1997, Oncogene. 14 (22): 2721-8.
  • Swanson. et al., 2004, Nat Struct Mol Biol. 11 (8): 738-46.
  • HBP1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    HBP1 cDNA ORF Clone in Cloning Vector, Rat RG85479-U
    HBP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85479-ACGLN

    HBP1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    HBP1 cDNA ORF Clone in Cloning Vector, Mouse MG51538-G
    HBP1 cDNA ORF Clone, Mouse, untagged MG51538-UT
    HBP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51538-ACGLN
    HBP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51538-ACG
    HBP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51538-ANG
    HBP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51538-ACR
    HBP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51538-ANR
    HBP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51538-CF
    HBP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51538-NF
    HBP1 cDNA ORF Clone, Mouse, C-His tag MG51538-CH
    HBP1 cDNA ORF Clone, Mouse, N-His tag MG51538-NH
    HBP1 cDNA ORF Clone, Mouse, C-HA tag MG51538-CY
    HBP1 cDNA ORF Clone, Mouse, N-HA tag MG51538-NY
    HBP1 cDNA ORF Clone, Mouse, C-Myc tag MG51538-CM
    HBP1 cDNA ORF Clone, Mouse, N-Myc tag MG51538-NM
    HBP1 qPCR Primer Pairs, Mouse MP201422

    HBP1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    HBP1 cDNA ORF Clone in Cloning Vector, Human HG14127-G
    HBP1 cDNA ORF Clone, Human, untagged HG14127-UT
    HBP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14127-ACG
    HBP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14127-ACGLN
    HBP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14127-ANG
    HBP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14127-ACR
    HBP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14127-ANR
    HBP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14127-CF
    HBP1 cDNA ORF Clone, Human, C-His tag HG14127-CH
    HBP1 cDNA ORF Clone, Human, N-His tag HG14127-NH
    HBP1 cDNA ORF Clone, Human, C-HA tag HG14127-CY
    HBP1 cDNA ORF Clone, Human, N-HA tag HG14127-NY
    HBP1 cDNA ORF Clone, Human, C-Myc tag HG14127-CM
    HBP1 cDNA ORF Clone, Human, N-Myc tag HG14127-NM
    HBP1 qPCR Primer Pairs, Human HP102780
    info info
    添加购物车成功! 添加购物车失败!