Quick Order

Human HB-EGF ORF mammalian expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human HBEGF cDNA Clone Product Information
NCBI RefSeq:NM_001945.2
RefSeq ORF Size:627bp
cDNA Description:Full length Clone DNA of Homo sapiens heparin-binding EGF-like growth factor with N terminal Myc tag.
Gene Synonym:DTR, DTS, DTSF, HEGFL
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:pCMV3-Myc-HBEGF
Restriction Site:HindIII+XbaI (6kb+0.66kb)
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 309C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human HBEGF Gene Plasmid Map
Human HB-EGF ORF mammalian expression plasmid, N-Myc tag
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Heparin-binding EGF-like growth factor (HBEGF), a member of the EGF family of growth factors, exerts its biological activity through activation of the EGFR and other ErbB receptors. Soluble mature HBEGF is proteolytically processed from a larger membrane-anchored precursor and is a potent mitogen and chemotactic factor for fibroblasts, smooth muscle cells but not endothelial cells. HBEGF activates two EGF receptor subtypes, HER1 and HER4 and binds to cell surface HSPG. The transmembrane form of HBEGF is a juxtacrine growth and adhesion factor and is uniquely the receptor for diphtheria toxin. Both forms of HB-EGF participate in normal physiological processes and in pathological processes including tumor progression and metastasis, organ hyperplasia, and atherosclerotic disease. HBEGF participates in diverse biological processes, including heart development and maintenance, skin wound healing, eyelid formation, blastocyst implantation, progression of atherosclerosis and tumor formation, through the activation of signaling molecules downstream of ErbB receptors and interactions with molecules associated with HBEGF. tumor necrosis factor-alpha (TNF-alpha) and interleukin-1 beta markedly increased HB-EGF mRNA levels in HUVEC by 12- and 7-fold, respectively, and induction of the gene by TNF-alpha was both dose- and time-dependent.

References
  • Miyamoto S, et al. (2006) Heparin-binding epidermal growth factor-like growth factor as a novel targeting molecule for cancer therapy. Cancer Sci. 97(5): 341-7.
  • Raab G, et al. (1997) Heparin-binding EGF-like growth factor. Biochim Biophys Acta. 1333(3): 179-99.
  • Pathak BG, et al. (1995) Mouse chromosomal location of three EGF receptor ligands: amphiregulin (Areg), betacellulin (Btc), and heparin-binding EGF (Hegfl). Genomics. 28(1): 116-8.
  • Size / Price
    Catalog: HG10325-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"