Quick Order

Text Size:AAA

Human HAO1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human HAO1 cDNA Clone Product Information
NCBI RefSeq:NM_017545.2
RefSeq ORF Size:1113bp
cDNA Description:Full length Clone DNA of Homo sapiens hydroxyacid oxidase (glycolate oxidase) 1.
Gene Synonym:GOX, GOX1, HAOX1, MGC142225, MGC142227, HAO1
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Hydroxyacid oxidase 1, also known as Glycolate oxidase, HAO1 and GOX1, is a member of the FMN-dependent alpha-hydroxy acid dehydrogenase family. HAO1 / GOX1 has 2-hydroxyacid oxidase activity. It is most active on the 2-carbon substrate glycolate, but is also active on 2-hydroxy fatty acids, with high activity towards 2-hydroxy palmitate and 2-hydroxy octanoate. HAO1 / GOX1 is a liver-specific peroxisomal enzyme that oxidizes glycolate to glyoxylate with concomitant production of H2O2. In Hao1 messenger RNA (mRNA), an iron-responsive element (IRE) homologous to the sequence recognized by iron regulatory proteins (IRP), key regulators of iron homeostasis, is present. Mammalian HAO1 / GOX1 is a peroxisomal protein and that the C-terminal sequence SKI acts as the targeting signal. Down-regulation of HAO1 / GOX1 expression during oxidative stress may provide a mechanism to prevent excessive H2O2 formation in liver peroxisomes and may represent the prototype of a poorly recognized but potentially relevant response to oxidative injury involving down-regulation of ROS-producing enzymes.

References
  • Jones J.M.et al., 2000, J. Biol. Chem. 275:12590-7.
  • Recalcati,S. et al., 2001, J Cell Sci. 114 (Pt 9):1625-9.
  • Recalcati,S. et al., 2003, Hepatology. 38 (5):1159-66.
  • Murray M.S.et al., 2008, Biochemistry 47:2439-49.
  • Bourhis J.M.et al., 2009, Acta Crystallogr. F 65:1246-53.
  • Size / Price
    Catalog: HG12076-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"