H3F3A cDNA ORF Clone, Human, C-HA tag

Cat: HG16451-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All H3F3A Reagents
CRO Services
Product recommended

All H3F3A Reagents
H3F3A cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
453 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human H3 histone, family 3A with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Restriction Sites
KpnI + XbaI(6kb+0.45kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
H3F3A cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

H3F3A cDNA ORF Clone, Human, C-HA tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5612
H3F3A cDNA ORF Clone, Human, C-HA tag Alternative Names
H3.3A cDNA ORF Clone, Human;H3F3 cDNA ORF Clone, Human
H3F3A Background Information
Full Name
H3 histone, family 3A

H3F3A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
H3F3A cDNA ORF Clone in Cloning Vector, Mouse MG51887-G
H3F3A cDNA ORF Clone, Mouse, untagged MG51887-UT
H3F3A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51887-ACGLN
H3F3A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51887-ACG
H3F3A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51887-ACR
H3F3A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51887-CF
H3F3A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51887-NF
H3F3A cDNA ORF Clone, Mouse, C-His tag MG51887-CH
H3F3A cDNA ORF Clone, Mouse, N-His tag MG51887-NH
H3F3A cDNA ORF Clone, Mouse, C-HA tag MG51887-CY
H3F3A cDNA ORF Clone, Mouse, N-HA tag MG51887-NY
H3F3A cDNA ORF Clone, Mouse, C-Myc tag MG51887-CM
H3F3A cDNA ORF Clone, Mouse, N-Myc tag MG51887-NM
H3F3A qPCR Primer Pairs, Mouse MP201760

H3F3A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
H3F3A cDNA ORF Clone in Cloning Vector, Human HG16451-G
H3F3A cDNA ORF Clone, Human, untagged HG16451-UT
H3F3A cDNA ORF Clone, Human, C-GFPSpark® tag HG16451-ACG
H3F3A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16451-ACGLN
H3F3A cDNA ORF Clone, Human, N-GFPSpark® tag HG16451-ANG
H3F3A cDNA ORF Clone, Human, C-OFPSpark® tag HG16451-ACR
H3F3A cDNA ORF Clone, Human, N-OFPSpark® tag HG16451-ANR
H3F3A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16451-CF
H3F3A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16451-NF
H3F3A cDNA ORF Clone, Human, C-His tag HG16451-CH
H3F3A cDNA ORF Clone, Human, N-His tag HG16451-NH
H3F3A cDNA ORF Clone, Human, N-HA tag HG16451-NY
H3F3A cDNA ORF Clone, Human, C-Myc tag HG16451-CM
H3F3A cDNA ORF Clone, Human, N-Myc tag HG16451-NM
H3F3A qPCR Primer Pairs, Human HP105197
info info
添加购物车成功! 添加购物车失败!