Histone H2A.Z cDNA ORF Clone, Human, C-HA tag

Cat: HG15279-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Histone H2A.Z Reagents
CRO Services
Product recommended

All Histone H2A.Z Reagents
Histone H2A.Z cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
387 bp
Description
Full length Clone DNA of Human H2A histone family, member Z with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Histone H2A.Z cDNA ORF Clone, Human, C-HA tag Alternative Names
H2A.z cDNA ORF Clone, Human;H2A.Z-1 cDNA ORF Clone, Human;H2A/z cDNA ORF Clone, Human;H2AZ cDNA ORF Clone, Human
Histone H2A.Z Background Information
Full Name
H2A histone family member Z

Histone H2A.Z cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
Histone H2A.Z cDNA ORF Clone in Cloning Vector, Rhesus CG90418-G
Histone H2A.Z cDNA ORF Clone, Rhesus, untagged CG90418-UT
Histone H2A.Z Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90418-ACGLN
Histone H2A.Z cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90418-ACG
Histone H2A.Z cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90418-ANG
Histone H2A.Z cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90418-ACR
Histone H2A.Z cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90418-ANR
Histone H2A.Z cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90418-CF
Histone H2A.Z cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90418-NF
Histone H2A.Z cDNA ORF Clone, Rhesus, C-His tag CG90418-CH
Histone H2A.Z cDNA ORF Clone, Rhesus, N-His tag CG90418-NH
Histone H2A.Z cDNA ORF Clone, Rhesus, C-HA tag CG90418-CY
Histone H2A.Z cDNA ORF Clone, Rhesus, N-HA tag CG90418-NY
Histone H2A.Z cDNA ORF Clone, Rhesus, C-Myc tag CG90418-CM
Histone H2A.Z cDNA ORF Clone, Rhesus, N-Myc tag CG90418-NM

Histone H2A.Z cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Histone H2A.Z cDNA ORF Clone in Cloning Vector, Rat RG80764-U
Histone H2A.Z cDNA ORF Clone, Rat, untagged RG80764-UT
Histone H2A.Z Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80764-ACGLN
Histone H2A.Z cDNA ORF Clone, Rat, C-GFPSpark® tag RG80764-ACG
Histone H2A.Z cDNA ORF Clone, Rat, N-GFPSpark® tag RG80764-ANG
Histone H2A.Z cDNA ORF Clone, Rat, C-OFPSpark® tag RG80764-ACR
Histone H2A.Z cDNA ORF Clone, Rat, N-OFPSpark® tag RG80764-ANR
Histone H2A.Z cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80764-CF
Histone H2A.Z cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80764-NF
Histone H2A.Z cDNA ORF Clone, Rat, C-His tag RG80764-CH
Histone H2A.Z cDNA ORF Clone, Rat, N-His tag RG80764-NH
Histone H2A.Z cDNA ORF Clone, Rat, C-HA tag RG80764-CY
Histone H2A.Z cDNA ORF Clone, Rat, N-HA tag RG80764-NY
Histone H2A.Z cDNA ORF Clone, Rat, C-Myc tag RG80764-CM
Histone H2A.Z cDNA ORF Clone, Rat, N-Myc tag RG80764-NM
Histone H2A.Z qPCR Primer Pairs, Rat RP300728

Histone H2A.Z cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Histone H2A.Z cDNA ORF Clone in Cloning Vector, Mouse MG52220-G
Histone H2A.Z cDNA ORF Clone, Mouse, untagged MG52220-UT
Histone H2A.Z Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52220-ACGLN
Histone H2A.Z cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52220-ACG
Histone H2A.Z cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52220-ANG
Histone H2A.Z cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52220-ACR
Histone H2A.Z cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52220-ANR
Histone H2A.Z cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52220-CF
Histone H2A.Z cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52220-NF
Histone H2A.Z cDNA ORF Clone, Mouse, C-His tag MG52220-CH
Histone H2A.Z cDNA ORF Clone, Mouse, N-His tag MG52220-NH
Histone H2A.Z cDNA ORF Clone, Mouse, C-HA tag MG52220-CY
Histone H2A.Z cDNA ORF Clone, Mouse, N-HA tag MG52220-NY
Histone H2A.Z cDNA ORF Clone, Mouse, C-Myc tag MG52220-CM
Histone H2A.Z cDNA ORF Clone, Mouse, N-Myc tag MG52220-NM
Histone H2A.Z qPCR Primer Pairs, Mouse MP202093

Histone H2A.Z cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Histone H2A.Z cDNA ORF Clone in Cloning Vector, Human HG15279-G
Histone H2A.Z cDNA ORF Clone, Human, untagged HG15279-UT
Histone H2A.Z cDNA ORF Clone, Human, C-GFPSpark® tag HG15279-ACG
Histone H2A.Z Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15279-ACGLN
Histone H2A.Z cDNA ORF Clone, Human, N-GFPSpark® tag HG15279-ANG
Histone H2A.Z cDNA ORF Clone, Human, C-OFPSpark® tag HG15279-ACR
Histone H2A.Z cDNA ORF Clone, Human, N-OFPSpark® tag HG15279-ANR
Histone H2A.Z cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15279-CF
Histone H2A.Z cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15279-NF
Histone H2A.Z cDNA ORF Clone, Human, C-His tag HG15279-CH
Histone H2A.Z cDNA ORF Clone, Human, N-His tag HG15279-NH
Histone H2A.Z cDNA ORF Clone, Human, N-HA tag HG15279-NY
Histone H2A.Z cDNA ORF Clone, Human, C-Myc tag HG15279-CM
Histone H2A.Z cDNA ORF Clone, Human, N-Myc tag HG15279-NM
Histone H2A.Z qPCR Primer Pairs, Human HP103905
info info
添加购物车成功! 添加购物车失败!