Quick Order

Human GCAP1 / GUCA1A Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human GUCA1A cDNA Clone Product Information
NCBI RefSeq:BC031663
RefSeq ORF Size:606bp
cDNA Description:Full length Clone DNA of Homo sapiens guanylate cyclase activator 1A (retina).
Gene Synonym:COD3, GCAP, GUCA, GCAP1, GUCA1, CORD14, C6orf131, dJ139D8.6
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

GCAP 1 gene plays a role in the recovery of retinal photoreceptors from photobleaching. In the recovery phase, the phototransduction messeneger cGMP is replenished by retinal guanylyl cyclase-1 (GC1). GC1 is activated by decreasing Ca(2+) concentrations following photobleaching. The protein encoded by this gene, guanylyl cyclase activating protein 1 (GCAP 1), mediates the sensitivity of GC1 to Ca(2+) concentrations. GCAP 1 promotes activity of GC1 at low Ca(2+) concentrations and inhibits GC1 activity at high Ca(2+) concentrations. Mutations in GCAP 1 gene cause autosomal dominant cone dystrophy (COD3); a disease characterized by reduced visual acuity associated with progressive loss of color vision. GCAP 1 stimulates guanylyl cyclase 1 (GC1) when free calcium ions concentration is low and inhibits GC1 when free calcium ions concentration is elevated. This Ca(2+)-sensitive regulation of GC is a key event in recovery of the dark state of rod photoreceptors following light exposure.

References
  • Surguchov A, et al. (1997) The human GCAP1 and GCAP2 genes are arranged in a tail-to-tail array on the short arm of chromosome 6 (p21.1). Genomics. 39(3):312-22.
  • Subbaraya I, et al. (1995) Molecular characterization of human and mouse photoreceptor guanylate cyclase-activating protein (GCAP) and chromosomal localization of the human gene. J Biol Chem. 269(49):31080-9.
  • Payne AM, et al. (1998) A mutation in guanylate cyclase activator 1A (GCAP 1) in an autosomal dominant cone dystrophy pedigree mapping to a new locus on chromosome 6p21.1. Hum Mol Genet. 7(2):273-7.
  • Size / Price
    Catalog: HG14565-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"