GSTO1 cDNA ORF Clone, Human, N-His tag

Cat: HG14296-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GSTO1 Reagents
CRO Services
Product recommended

All GSTO1 Reagents
GSTO1 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
726 bp
Description
Full length Clone DNA of Human glutathione S-transferase omega 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GSTO1 cDNA ORF Clone, Human, N-His tag Alternative Names
GSTO 1-1 cDNA ORF Clone, Human;GSTTLp28 cDNA ORF Clone, Human;HEL-S-21 cDNA ORF Clone, Human;P28 cDNA ORF Clone, Human;SPG-R cDNA ORF Clone, Human
GSTO1 Background Information
Full Name
glutathione S-transferase omega 1

GSTO1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GSTO1 cDNA ORF Clone in Cloning Vector, Rat RG83646-U
GSTO1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83646-ACGLN

GSTO1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GSTO1 cDNA ORF Clone in Cloning Vector, Mouse MG53142-G
GSTO1 cDNA ORF Clone, Mouse, untagged MG53142-UT
GSTO1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53142-ACGLN
GSTO1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53142-ACG
GSTO1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53142-ANG
GSTO1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53142-ACR
GSTO1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53142-ANR
GSTO1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53142-CF
GSTO1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53142-NF
GSTO1 cDNA ORF Clone, Mouse, C-His tag MG53142-CH
GSTO1 cDNA ORF Clone, Mouse, N-His tag MG53142-NH
GSTO1 cDNA ORF Clone, Mouse, C-HA tag MG53142-CY
GSTO1 cDNA ORF Clone, Mouse, N-HA tag MG53142-NY
GSTO1 cDNA ORF Clone, Mouse, C-Myc tag MG53142-CM
GSTO1 cDNA ORF Clone, Mouse, N-Myc tag MG53142-NM

GSTO1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GSTO1 cDNA ORF Clone in Cloning Vector, Human HG14296-G
GSTO1 cDNA ORF Clone, Human, untagged HG14296-UT
GSTO1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14296-ACGLN
GSTO1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14296-ACG
GSTO1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14296-ANG
GSTO1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14296-ACR
GSTO1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14296-ANR
GSTO1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14296-CF
GSTO1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14296-NF
GSTO1 cDNA ORF Clone, Human, C-His tag HG14296-CH
GSTO1 cDNA ORF Clone, Human, C-HA tag HG14296-CY
GSTO1 cDNA ORF Clone, Human, N-HA tag HG14296-NY
GSTO1 cDNA ORF Clone, Human, C-Myc tag HG14296-CM
GSTO1 cDNA ORF Clone, Human, N-Myc tag HG14296-NM
GSTO1 qPCR Primer Pairs, Human HP102946
info info
添加购物车成功! 添加购物车失败!