Quick Order

Human GSTM2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human GSTM2 cDNA Clone Product Information
    NCBI RefSeq:NM_000848
    RefSeq ORF Size:657bp
    cDNA Description:Full length Clone DNA of Homo sapiens glutathione S-transferase mu 2 (muscle), transcript variant 1 with C terminal His tag.
    Gene Synonym:GST4
    Species:Human
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with GSTM2 qPCR primers for gene expression analysis, HP101576 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Background

    Glutathione S-transferase Mu 2, also known as GST class-mu 2, GSTM2-2 and GSTM2, is a cytoplasm protein which belongs to the GST superfamily and Mu family. GSTM2 / GST4 contains one GST C-terminal domain and one GST N-terminal domain. The glutathione S-transferases (GSTs) are a multigene family of enzymes largely involved in the detoxification of chemicals. Eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. Butyrate, an important luminal component produced from fermentation of dietary fibers, is an efficient inducer of GSTs and especially of GSTM2. Butyrate may act chemoprotectively by increasing detoxification capabilities in the colon mucosa.

    References
  • Campbell E, et al.,1990, J Biol Chem 265 (16): 9188-93. 
  • Vorachek WR, et al.,1991, Proc Natl Acad Sci USA. 88 (10): 4443-7.
  • Ebert,M.N. et al., 2003, Carcinogenesis. 24 (10):1637-44.
  • Size / Price
    Catalog: HG12042-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"