Gremlin 1 cDNA ORF Clone, Human, C-HA tag

Cat: HG10632-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Gremlin 1 Reagents
CRO Services
Product recommended

All Gremlin 1 Reagents
Gremlin 1 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
555 bp
Description
Full length Clone DNA of Human gremlin 1, cysteine knot superfamily, homolog (Xenopus laevis) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Gremlin 1 cDNA ORF Clone, Human, C-HA tag Alternative Names
C15DUPq cDNA ORF Clone, Human;CKTSF1B1 cDNA ORF Clone, Human;CRAC1 cDNA ORF Clone, Human;CRCS4 cDNA ORF Clone, Human;DAND2 cDNA ORF Clone, Human;DRM cDNA ORF Clone, Human;DUP15q cDNA ORF Clone, Human;GREMLIN cDNA ORF Clone, Human;HMPS cDNA ORF Clone, Human;HMPS1 cDNA ORF Clone, Human;IHG-2 cDNA ORF Clone, Human;MPSH cDNA ORF Clone, Human;PIG2 cDNA ORF Clone, Human
Gremlin 1 Background Information

GREM1 belongs to the DAN family. It contains 1 CTCK (C-terminal cystine knot-like) domain. GREM1 is a cysteine knot-secreted protein and acts as an inhibitor in the TGF beta signaling pathway. It inhibits BMP-2, -4, and -7. Inhibition by grem 1 of BMPs in mice allow the expression of fibroblast growth factors (FGFs) 4 and 8 and Sonic hedgehog (SHH) which are necessary for proper limb development. It interacts with SLIT1 and SLIT2 in a glycosylation-dependent manner. As a cytokine, GREM1 may play an important role during carcinogenesis and metanephric kidney organogenesis, as a BMP antagonist required for early limb outgrowth and patterning in maintaining the FGF4-SHH feedback loop. It down-regulates the BMP4 signaling in a dose-dependent manner. It also acts as inhibitor of monocyte chemotaxis. GREM1 is highly expressed in small intestine, fetal brain and colon.

Full Name
gremlin 1, DAN family BMP antagonist
References
  • Dimitrov BI, et al. (2010) Genomic rearrangements of the GREM1-FMN1 locus cause oligosyndactyly, radio-ulnar synostosis, hearing loss, renal defects syndrome and Cenani--Lenz-like non-syndromic oligosyndactyly. J Med Genet. 47(8):569-74.
  • Heron M, et al. (2011) Genetic variation in GREM1 is a risk factor for fibrosis in pulmonary sarcoidosis. Tissue Antigens. 77(2):112-7.
  • van Vlodrop IJ, et al. (2010) Prognostic significance of Gremlin1 (GREM1) promoter CpG island hypermethylation in clear cell renal cell carcinoma. Am J Pathol. 176(2):575-84.
  • Gremlin 1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Gremlin 1 cDNA ORF Clone in Cloning Vector, Mouse MG50016-M
    Gremlin 1 cDNA ORF Clone, Mouse, untagged MG50016-UT
    Gremlin 1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50016-ACGLN
    Gremlin 1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50016-ACG
    Gremlin 1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50016-ACR
    Gremlin 1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50016-CF
    Gremlin 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50016-NF
    Gremlin 1 cDNA ORF Clone, Mouse, C-His tag MG50016-CH
    Gremlin 1 cDNA ORF Clone, Mouse, N-His tag MG50016-NH
    Gremlin 1 cDNA ORF Clone, Mouse, C-HA tag MG50016-CY
    Gremlin 1 cDNA ORF Clone, Mouse, N-HA tag MG50016-NY
    Gremlin 1 cDNA ORF Clone, Mouse, C-Myc tag MG50016-CM
    Gremlin 1 cDNA ORF Clone, Mouse, N-Myc tag MG50016-NM
    Gremlin 1 qPCR Primer Pairs, Mouse MP200016

    Gremlin 1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Gremlin 1 cDNA ORF Clone in Cloning Vector, Human HG10632-G
    Gremlin 1 cDNA ORF Clone, Human, untagged HG10632-UT
    Gremlin 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10632-ACGLN
    Gremlin 1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10632-ACG
    Gremlin 1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10632-ACR
    Gremlin 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10632-CF
    Gremlin 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10632-NF
    Gremlin 1 cDNA ORF Clone, Human, C-His tag HG10632-CH
    Gremlin 1 cDNA ORF Clone, Human, N-His tag HG10632-NH
    Gremlin 1 cDNA ORF Clone, Human, N-HA tag HG10632-NY
    Gremlin 1 cDNA ORF Clone, Human, C-Myc tag HG10632-CM
    Gremlin 1 cDNA ORF Clone, Human, N-Myc tag HG10632-NM
    Gremlin 1 qPCR Primer Pairs, Human HP100608
    info info
    添加购物车成功! 添加购物车失败!