GPKOW cDNA ORF Clone, Human, untagged

Cat: HG14467-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GPKOW Reagents
CRO Services
Product recommended

All GPKOW Reagents
GPKOW cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1431 bp
Description
Full length Clone DNA of Human G patch domain and KOW motifs.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GPKOW cDNA ORF Clone, Human, untagged Alternative Names
GPATC5 cDNA ORF Clone, Human;GPATCH5 cDNA ORF Clone, Human;Spp2 cDNA ORF Clone, Human;T54 cDNA ORF Clone, Human
GPKOW Background Information
Full Name
G patch domain and KOW motifs

GPKOW cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GPKOW cDNA ORF Clone in Cloning Vector, Mouse MG5A4590-U
GPKOW cDNA ORF Clone, Mouse, untagged MG5A4590-UT
GPKOW cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4590-ACG
GPKOW Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4590-ACGLN
GPKOW cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A4590-ANG
GPKOW cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A4590-ACR
GPKOW cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A4590-ANR
GPKOW cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A4590-CF
GPKOW cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A4590-NF
GPKOW cDNA ORF Clone, Mouse, C-His tag MG5A4590-CH
GPKOW cDNA ORF Clone, Mouse, N-His tag MG5A4590-NH
GPKOW cDNA ORF Clone, Mouse, C-HA tag MG5A4590-CY
GPKOW cDNA ORF Clone, Mouse, N-HA tag MG5A4590-NY
GPKOW cDNA ORF Clone, Mouse, C-Myc tag MG5A4590-CM
GPKOW cDNA ORF Clone, Mouse, N-Myc tag MG5A4590-NM

GPKOW cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GPKOW cDNA ORF Clone in Cloning Vector, Human HG14467-G
GPKOW cDNA ORF Clone, Human, C-GFPSpark® tag HG14467-ACG
GPKOW Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14467-ACGLN
GPKOW cDNA ORF Clone, Human, N-GFPSpark® tag HG14467-ANG
GPKOW cDNA ORF Clone, Human, C-OFPSpark® tag HG14467-ACR
GPKOW cDNA ORF Clone, Human, N-OFPSpark® tag HG14467-ANR
GPKOW cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14467-CF
GPKOW cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14467-NF
GPKOW cDNA ORF Clone, Human, C-His tag HG14467-CH
GPKOW cDNA ORF Clone, Human, N-His tag HG14467-NH
GPKOW cDNA ORF Clone, Human, C-HA tag HG14467-CY
GPKOW cDNA ORF Clone, Human, N-HA tag HG14467-NY
GPKOW cDNA ORF Clone, Human, C-Myc tag HG14467-CM
GPKOW cDNA ORF Clone, Human, N-Myc tag HG14467-NM
GPKOW qPCR Primer Pairs, Human HP103115
info info
添加购物车成功! 添加购物车失败!