GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Human, C-Myc tag

Cat: HG11352-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GPI/Glucose 6 phosphate isomerase Reagents
CRO Services
Product recommended

All GPI/Glucose 6 phosphate isomerase Reagents
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1722 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human rabaptin, RAB GTPase binding effector protein 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Restriction Sites
HindIII + XbaI(6kb+1.72kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
GPI/Glucose 6 phosphate isomerase cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Human, C-Myc tag Validated Images
Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5621
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Human, C-Myc tag Alternative Names
AMF cDNA ORF Clone, Human;GNPI cDNA ORF Clone, Human;NLK cDNA ORF Clone, Human;PGI cDNA ORF Clone, Human;PHI cDNA ORF Clone, Human;SA-36 cDNA ORF Clone, Human;SA36 cDNA ORF Clone, Human
GPI/Glucose 6 phosphate isomerase Background Information
Full Name
glucose-6-phosphate isomerase

GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone in Cloning Vector, Rabbit TG65062-G
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Rabbit, untagged TG65062-UT
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65062-ACG
GPI/Glucose 6 phosphate isomerase Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65062-ACGLN
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65062-ANG
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65062-ACR
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65062-ANR
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65062-CF
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65062-NF
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Rabbit, C-His tag TG65062-CH
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Rabbit, N-His tag TG65062-NH
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Rabbit, C-HA tag TG65062-CY
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Rabbit, N-HA tag TG65062-NY
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Rabbit, C-Myc tag TG65062-CM
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Rabbit, N-Myc tag TG65062-NM

GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone in Cloning Vector, Rat RG81143-G
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Rat, untagged RG81143-UT
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Rat, C-GFPSpark® tag RG81143-ACG
GPI/Glucose 6 phosphate isomerase Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81143-ACGLN
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Rat, C-OFPSpark® tag RG81143-ACR
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81143-CF
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81143-NF
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Rat, C-His tag RG81143-CH
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Rat, N-His tag RG81143-NH
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Rat, C-HA tag RG81143-CY
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Rat, N-HA tag RG81143-NY
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Rat, C-Myc tag RG81143-CM
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Rat, N-Myc tag RG81143-NM
GPI/Glucose 6 phosphate isomerase qPCR Primer Pairs, Rat RP301099

GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone in Cloning Vector, Human HG11352-M
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Human, untagged HG11352-UT
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Human, C-GFPSpark® tag HG11352-ACG
GPI/Glucose 6 phosphate isomerase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11352-ACGLN
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Human, N-GFPSpark® tag HG11352-ANG
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Human, C-OFPSpark® tag HG11352-ACR
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Human, N-OFPSpark® tag HG11352-ANR
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11352-CF
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11352-NF
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Human, C-His tag HG11352-CH
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Human, N-His tag HG11352-NH
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Human, C-HA tag HG11352-CY
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Human, N-HA tag HG11352-NY
GPI/Glucose 6 phosphate isomerase cDNA ORF Clone, Human, N-Myc tag HG11352-NM
GPI/Glucose 6 phosphate isomerase qPCR Primer Pairs, Human HP101237
info info
添加购物车成功! 添加购物车失败!