Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Human, untagged

Cat: HG15489-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Glycerol 3 Phosphate Dehydrogenase Reagents
CRO Services
Product recommended

All Glycerol 3 Phosphate Dehydrogenase Reagents
Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1050 bp
Description
Full length Clone DNA of Human glycerol-3-phosphate dehydrogenase 1 (soluble).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Human, untagged Alternative Names
GPD-C cDNA ORF Clone, Human;GPDH-C cDNA ORF Clone, Human;HTGTI cDNA ORF Clone, Human
Glycerol 3 Phosphate Dehydrogenase Background Information

GPD1, also known as glycerolphosphate dehydrogenase 1, is a member of the NAD-dependent glycerol-3-phosphate dehydrogenase family. GPD1 catalyzes the reversible redox conversion of dihydroxyacetone phosphate (DHAP), thus plays a critical role in carbohydrate and lipid metabolism. It also reduces nicotine adenine dinucleotide (NADH) to glycerol-3-phosphate (G3P) and NAD+. Meanwhile, GPD1 and mitochondrial glycerol-3-phosphate dehydrogenase also form a glycerol phosphate shuttle that facilitates the transfer of reducing equivalents from the cytosol to mitochondria. Mutations in GPD1 gene are a cause of transient infantile hypertriglyceridemia.

Full Name
glycerol-3-phosphate dehydrogenase 1 (soluble)
References
  • Ou X. et al., 2006, J Mol Biol. 357 (3): 858-69.
  • Ou Xianjin. et al., 2011, Journal of Molecular Biology. 357 (3): 858-69.
  • Harding Jr. et al., 1975, Biochem Journal. 146: 223-9.
  • Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone in Cloning Vector, Rat RG80977-U
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Rat, untagged RG80977-UT
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Rat, C-GFPSpark® tag RG80977-ACG
    Glycerol 3 Phosphate Dehydrogenase Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80977-ACGLN
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Rat, N-GFPSpark® tag RG80977-ANG
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Rat, C-OFPSpark® tag RG80977-ACR
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Rat, N-OFPSpark® tag RG80977-ANR
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80977-CF
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80977-NF
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Rat, C-His tag RG80977-CH
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Rat, N-His tag RG80977-NH
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Rat, C-HA tag RG80977-CY
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Rat, N-HA tag RG80977-NY
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Rat, C-Myc tag RG80977-CM
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Rat, N-Myc tag RG80977-NM
    Glycerol 3 Phosphate Dehydrogenase qPCR Primer Pairs, Rat RP300941

    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone in Cloning Vector, Mouse MG52892-G
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Mouse, untagged MG52892-UT
    Glycerol 3 Phosphate Dehydrogenase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52892-ACGLN
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52892-ACG
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52892-ANG
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52892-ACR
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52892-ANR
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52892-CF
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52892-NF
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Mouse, C-His tag MG52892-CH
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Mouse, N-His tag MG52892-NH
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Mouse, C-HA tag MG52892-CY
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Mouse, N-HA tag MG52892-NY
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Mouse, C-Myc tag MG52892-CM
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Mouse, N-Myc tag MG52892-NM

    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone in Cloning Vector, Human HG15489-G
    Glycerol 3 Phosphate Dehydrogenase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15489-ACGLN
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Human, C-GFPSpark® tag HG15489-ACG
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Human, N-GFPSpark® tag HG15489-ANG
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Human, C-OFPSpark® tag HG15489-ACR
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Human, N-OFPSpark® tag HG15489-ANR
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15489-CF
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15489-NF
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Human, C-His tag HG15489-CH
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Human, N-His tag HG15489-NH
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Human, C-HA tag HG15489-CY
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Human, N-HA tag HG15489-NY
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Human, C-Myc tag HG15489-CM
    Glycerol 3 Phosphate Dehydrogenase cDNA ORF Clone, Human, N-Myc tag HG15489-NM
    Glycerol 3 Phosphate Dehydrogenase qPCR Primer Pairs, Human HP104111
    info info
    添加购物车成功! 添加购物车失败!