Quick Order

Human GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human GPD1 cDNA Clone Product Information
NCBI RefSeq:BC032234
RefSeq ORF Size:1050bp
cDNA Description:Full length Clone DNA of Homo sapiens glycerol-3-phosphate dehydrogenase 1 (soluble) with N terminal His tag.
Gene Synonym:GPD-C, HTGTI, GPDH-C
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, N-His tag on other vectors
Human GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG15489-ACG$225
Human GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG15489-ACR$225
Human GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG15489-ANG$225
Human GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG15489-ANR$225
Human GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG15489-CF$195
Human GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, C-His tagHG15489-CH$195
Human GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG15489-CM$195
Human GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG15489-CY$195
Human GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone in cloning vectorHG15489-G$75
Human GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG15489-NF$195
Human GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, N-His tagHG15489-NH$195
Human GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG15489-NM$195
Human GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG15489-NY$195
Human GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmidHG15489-UT$195
 Learn more about expression Vectors
Product nameProduct name
Background

GPD1, also known as glycerolphosphate dehydrogenase 1, is a member of the NAD-dependent glycerol-3-phosphate dehydrogenase family. GPD1 catalyzes the reversible redox conversion of dihydroxyacetone phosphate (DHAP), thus plays a critical role in carbohydrate and lipid metabolism. It also reduces nicotine adenine dinucleotide (NADH) to glycerol-3-phosphate (G3P) and NAD+. Meanwhile, GPD1 and mitochondrial glycerol-3-phosphate dehydrogenase also form a glycerol phosphate shuttle that facilitates the transfer of reducing equivalents from the cytosol to mitochondria. Mutations in GPD1 gene are a cause of transient infantile hypertriglyceridemia.

References
  • Ou X. et al., 2006, J Mol Biol. 357 (3): 858-69.
  • Ou Xianjin. et al., 2011, Journal of Molecular Biology. 357 (3): 858-69.
  • Harding Jr. et al., 1975, Biochem Journal. 146: 223-9.
  • Size / Price
    Catalog: HG15489-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"