Glypican 5 cDNA ORF Clone, Human, C-Myc tag

Cat: HG10079-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Glypican 5 Reagents
CRO Services
Product recommended

All Glypican 5 Reagents
Glypican 5 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1719 bp
Description
Full length Clone DNA of Human glypican 5 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Glypican 5 Background Information

Glypican-5 (GPC5), is a cell membrane protein which belongs to the glypican family. The glypicans compose a family of glycosylphosphatidylinositol-anchored heparan sulfate proteoglycans that may play a role in the control of cell division and growth regulation. So far, six members (Glypican-1/GPC1, Glypican-2/GPC2, Glypican-3/GPC3, Glypican-4/GPC4, Glypican-5/GPC5, Glypican-6/GPC6) of this family are known in vertebrates. In adult, Glypican-5 is primarily expressed in the brain. It is also detected in fetal brain, lung and liver. Glypican-5 enhances the intracellular signaling of FGF2 and HGF. It alters the cellular distribution of FGF2. The properties of Glypican-5 make it an attractive target for therapeutic intervention in rhabdomyosarcomas and other tumors that amplify and/or overexpress its gene. Glypican-5 is over-expressed in lymphoma cell lines that had shown amplification. It is a likely target for amplification, and that over-expression of GPC5 may contribute to development and/or progression of lymphomas and other tumors.

Full Name
glypican 5
References
  • Yu W, et al. (2003) GPC5 is a possible target for the 13q31-q32 amplification detected in lymphoma cell lines. J Hum Genet. 48(6): 331-5.
  • Williamson D, et al. (2007) Role for amplification and expression of glypican-5 in rhabdomyosarcoma. Cancer Res. 67(1): 57-65.
  • Glypican 5 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Glypican 5 cDNA ORF Clone in Cloning Vector, Mouse MG50467-M
    Glypican 5 cDNA ORF Clone, Mouse, untagged MG50467-UT
    Glypican 5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50467-ACG
    Glypican 5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50467-ACGLN
    Glypican 5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50467-ACR
    Glypican 5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50467-CF
    Glypican 5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50467-NF
    Glypican 5 cDNA ORF Clone, Mouse, C-His tag MG50467-CH
    Glypican 5 cDNA ORF Clone, Mouse, N-His tag MG50467-NH
    Glypican 5 cDNA ORF Clone, Mouse, C-HA tag MG50467-CY
    Glypican 5 cDNA ORF Clone, Mouse, N-HA tag MG50467-NY
    Glypican 5 cDNA ORF Clone, Mouse, C-Myc tag MG50467-CM
    Glypican 5 cDNA ORF Clone, Mouse, N-Myc tag MG50467-NM

    Glypican 5 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Glypican 5 cDNA ORF Clone in Cloning Vector, Human HG10079-M
    Glypican 5 cDNA ORF Clone, Human, untagged HG10079-UT
    Glypican 5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10079-ACGLN
    Glypican 5 cDNA ORF Clone, Human, C-GFPSpark® tag HG10079-ACG
    Glypican 5 cDNA ORF Clone, Human, C-OFPSpark® tag HG10079-ACR
    Glypican 5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10079-CF
    Glypican 5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10079-NF
    Glypican 5 cDNA ORF Clone, Human, C-His tag HG10079-CH
    Glypican 5 cDNA ORF Clone, Human, N-His tag HG10079-NH
    Glypican 5 cDNA ORF Clone, Human, C-HA tag HG10079-CY
    Glypican 5 cDNA ORF Clone, Human, N-HA tag HG10079-NY
    Glypican 5 cDNA ORF Clone, Human, N-Myc tag HG10079-NM
    Glypican 5 qPCR Primer Pairs, Human HP100165
    info info
    添加购物车成功! 添加购物车失败!