A33 cDNA ORF Clone, Human, C-Myc tag

Cat: HG11277-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All A33 Reagents
CRO Services
Product recommended

All A33 Reagents
A33 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
960 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human glycoprotein A33 (transmembrane) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Restriction Sites
KpnI + XbaI (6kb + 1.01kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
A33 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

A33 cDNA ORF Clone, Human, C-Myc tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5611
A33 cDNA ORF Clone, Human, C-Myc tag Alternative Names
A33 cDNA ORF Clone, Human
A33 Background Information

Cell surface A33 antigen, also known as glycoprotein A33, is a single-pass type I  membrane protein which is expressed in normal gastrointestinal epithelium and in 95% of colon cancers. GPA33 contains one Ig-like C2-type (immunoglobulin-like) domain and one Ig-like V-type (immunoglobulin-like) domain. The open reading frame encodes a 319-amino acid polypeptide having a putative secretory signal sequence and 3 potential glycosylation sites. The predicted mature protein has a 213-amino acid extracellular region, a single transmembrane domain, and a 62-amino acid intracellular tail. Intracellular traffic and recycling to the cell surface appear to play a major role in GPA33 function and to have an influence on its surface density superseding translational regulation. GPA33 has become a promising target of immunologic therapy strategies, but its biologic function and potential role in tumorigenesis are unknown. EpCAM protein and GPA33 mRNA expressions are specific and sensitive markers of Barrett's metaplasia (BM). GPA33 may also play a role in cell-cell recognition and signaling.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
glycoprotein A33 (transmembrane)
References
  • Heath J.K., et al., 1997, Proc. Natl. Acad. Sci. USA. 94:469-74.
  • Ritter G., et al., 1997, Biochem. Biophys. Res. Commun. 236:682-6.
  • Frey,D. et al., 2008, Cancer Biother Radiopharm  23 (1):65-73.
  • Rageul,J. et al., 2009, Int J Cancer 125 (12):2802-9. 
  • A33 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    A33 cDNA ORF Clone in Cloning Vector, Mouse MG50559-M
    A33 cDNA ORF Clone, Mouse, untagged MG50559-UT
    A33 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50559-ACGLN
    A33 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50559-ACG
    A33 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50559-ACR
    A33 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50559-CF
    A33 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50559-NF
    A33 cDNA ORF Clone, Mouse, C-His tag MG50559-CH
    A33 cDNA ORF Clone, Mouse, N-His tag MG50559-NH
    A33 cDNA ORF Clone, Mouse, C-HA tag MG50559-CY
    A33 cDNA ORF Clone, Mouse, N-HA tag MG50559-NY
    A33 cDNA ORF Clone, Mouse, C-Myc tag MG50559-CM
    A33 cDNA ORF Clone, Mouse, N-Myc tag MG50559-NM
    A33 qPCR Primer Pairs, Mouse MP200551

    A33 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    A33 cDNA ORF Clone in Cloning Vector, Human HG11277-M
    A33 cDNA ORF Clone, Human, untagged HG11277-UT
    A33 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11277-ACGLN
    A33 cDNA ORF Clone, Human, C-GFPSpark® tag HG11277-ACG
    A33 cDNA ORF Clone, Human, C-OFPSpark® tag HG11277-ACR
    A33 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11277-CF
    A33 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11277-NF
    A33 cDNA ORF Clone, Human, C-His tag HG11277-CH
    A33 cDNA ORF Clone, Human, N-His tag HG11277-NH
    A33 cDNA ORF Clone, Human, C-HA tag HG11277-CY
    A33 cDNA ORF Clone, Human, N-HA tag HG11277-NY
    A33 cDNA ORF Clone, Human, N-Myc tag HG11277-NM
    A33 qPCR Primer Pairs, Human HP101158
    info info
    添加购物车成功! 添加购物车失败!