GOT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG14463-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All GOT2 Reagents
CRO Services
Product recommended

All GOT2 Reagents
GOT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1332 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI(6kb+1.33kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
GOT2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GOT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
GOT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
KAT4 cDNA ORF Clone, Human;KATIV cDNA ORF Clone, Human;mitAAT cDNA ORF Clone, Human
GOT2 Background Information
Full Name
glutamic-oxaloacetic transaminase 2, mitochondrial

GOT2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GOT2 cDNA ORF Clone in Cloning Vector, Rat RG81148-U
GOT2 cDNA ORF Clone, Rat, untagged RG81148-UT
GOT2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81148-ACGLN
GOT2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81148-ACG
GOT2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81148-ACR
GOT2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81148-CF
GOT2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81148-NF
GOT2 cDNA ORF Clone, Rat, C-His tag RG81148-CH
GOT2 cDNA ORF Clone, Rat, N-His tag RG81148-NH
GOT2 cDNA ORF Clone, Rat, C-HA tag RG81148-CY
GOT2 cDNA ORF Clone, Rat, N-HA tag RG81148-NY
GOT2 cDNA ORF Clone, Rat, C-Myc tag RG81148-CM
GOT2 cDNA ORF Clone, Rat, N-Myc tag RG81148-NM
GOT2 qPCR Primer Pairs, Rat RP301104

GOT2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GOT2 cDNA ORF Clone in Cloning Vector, Mouse MG51279-G
GOT2 cDNA ORF Clone, Mouse, untagged MG51279-UT
GOT2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51279-ACGLN
GOT2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51279-ACG
GOT2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51279-ANG
GOT2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51279-ACR
GOT2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51279-ANR
GOT2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51279-CF
GOT2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51279-NF
GOT2 cDNA ORF Clone, Mouse, C-His tag MG51279-CH
GOT2 cDNA ORF Clone, Mouse, N-His tag MG51279-NH
GOT2 cDNA ORF Clone, Mouse, C-HA tag MG51279-CY
GOT2 cDNA ORF Clone, Mouse, N-HA tag MG51279-NY
GOT2 cDNA ORF Clone, Mouse, C-Myc tag MG51279-CM
GOT2 cDNA ORF Clone, Mouse, N-Myc tag MG51279-NM
GOT2 qPCR Primer Pairs, Mouse MP201161

GOT2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GOT2 cDNA ORF Clone in Cloning Vector, Human HG14463-G
GOT2 cDNA ORF Clone, Human, untagged HG14463-UT
GOT2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14463-ACGLN
GOT2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14463-ACG
GOT2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14463-ANG
GOT2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14463-ACR
GOT2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14463-ANR
GOT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14463-NF
GOT2 cDNA ORF Clone, Human, C-His tag HG14463-CH
GOT2 cDNA ORF Clone, Human, N-His tag HG14463-NH
GOT2 cDNA ORF Clone, Human, C-HA tag HG14463-CY
GOT2 cDNA ORF Clone, Human, N-HA tag HG14463-NY
GOT2 cDNA ORF Clone, Human, C-Myc tag HG14463-CM
GOT2 cDNA ORF Clone, Human, N-Myc tag HG14463-NM
GOT2 qPCR Primer Pairs, Human HP103111
info info
添加购物车成功! 添加购物车失败!