Quick Order

Human GOPC / PIST Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human GOPC cDNA Clone Product Information
NCBI RefSeq:BC009553
RefSeq ORF Size:1365bp
cDNA Description:Full length Clone DNA of Homo sapiens golgi-associated PDZ and coiled-coil motif containing with N terminal His tag.
Gene Synonym:CAL, FIG, PIST, GOPC1, dJ94G16.2
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

GOPC, also known as PIST, interacts specifically with TC10 (a Rho-family small GTPase)] as a binding partner for Rhotekin. Rhotekin associates with PIST in vitro and in both polarized and non-polarized MDCK (Madin-Darby canine kidney) cells. The C-terminal SPV (Ser-Pro-Val) motif of Rhotekin binds to the PDZ domain of PIST. The co-localization of PIST and Rhotekin at the Golgi apparatus can be detected in non-polarized fibroblast-like MDCK cells and AJs (adherens junctions) in the fully polarized cells. PIST and Rhotekin are recruited from the cytosol to AJs as the cell becomes polarized. Expression of constitutively active Rho or prevention of Rhotekin-PIST interaction induced diffuse cytoplasmic distribution of Rhotekin in polarized MDCK cells. GOPC may regulate CFTR chloride currents and acid-induced ACCN3 currents by modulating cell surface expression of both channels. It may also regulate the intracellular trafficking of the ADR1B receptor. GOPC is ubiquitously expressed and its overexpression results in CFTR intracellular retention and degradation in the lysosomes.

References
  • Hicks SW. et al., 2005, J Biol Chem. 280 (32): 28944-51.
  • Ito H. et al., 2006, Biochem J Aug. 397 (3): 389-98.
  • Amin N. et al., 2012, Mol Psychiatry. 17 (11): 1116-29.
  • Size / Price
    Catalog: HG14911-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"