GOLPH2 cDNA ORF Clone, Human, N-His tag

Cat: HG13066-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GOLPH2 Reagents
CRO Services
Product recommended

All GOLPH2 Reagents
GOLPH2 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1206 bp
Description
Full length Clone DNA of Human golgi membrane protein 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GOLPH2 cDNA ORF Clone, Human, N-His tag Alternative Names
bA379P1.3 cDNA ORF Clone, Human;C9orf155 cDNA ORF Clone, Human;GOLPH2 cDNA ORF Clone, Human;GP73 cDNA ORF Clone, Human;HEL46 cDNA ORF Clone, Human;PSEC0257 cDNA ORF Clone, Human
GOLPH2 Background Information

Golgi membrane protein 1, also known as Golgi membrane protein GP73, Golgi phosphoprotein 2 and GOLM1, is a protein which belongs to the GOLM1 / CASC4 family. GOLM1 is widely expressed. It is highly expressed in colon, prostate, trachea and stomach. It is expressed at lower level in testis, muscle, lymphoid tissues, white blood cells and spleen. It is predominantly expressed by cells of the epithelial lineage. GOLM1 is expressed at low level in normal liver. Expression significantly increases in virus (HBV, HCV) infected liver. Expression of GOLM1 does not increase in liver disease due to non-viral causes (alcohol-induced liver disease, autoimmune hepatitis). Increased expression in hepatocytes appears to be a general feature of advanced liver disease. In liver tissue from patients with adult giant-cell hepatitis (GCH), GOLM1 is strongly expressed in hepatocyte-derived syncitial giant cells. GOLM1 is constitutively expressed by biliary epithelial cells but not by hepatocytes.

Full Name
golgi membrane protein 1
References
  • Kladney R.D., et al.,(2000), GP73, a novel Golgi-localized protein upregulated by viral infection. Gene 249:53-65.
  • Clark H.F., et al., (2003), The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment.Genome Res. 13:2265-2270.
  • Puri S., et al.,(2002), Cycling of early Golgi proteins via the cell surface and endosomes upon lumenal pH disruption.Traffic 3:641-653.
  • GOLPH2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    GOLPH2 cDNA ORF Clone, Rat, untagged RG8A5463-UT
    GOLPH2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A5463-ACGLN
    GOLPH2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A5463-ACG
    GOLPH2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG8A5463-ACR
    GOLPH2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG8A5463-CF
    GOLPH2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG8A5463-NF
    GOLPH2 cDNA ORF Clone, Rat, C-His tag RG8A5463-CH
    GOLPH2 cDNA ORF Clone, Rat, N-His tag RG8A5463-NH
    GOLPH2 cDNA ORF Clone, Rat, C-HA tag RG8A5463-CY
    GOLPH2 cDNA ORF Clone, Rat, N-HA tag RG8A5463-NY
    GOLPH2 cDNA ORF Clone, Rat, C-Myc tag RG8A5463-CM
    GOLPH2 cDNA ORF Clone, Rat, N-Myc tag RG8A5463-NM

    GOLPH2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GOLPH2 cDNA ORF Clone in Cloning Vector, Human HG13066-G
    GOLPH2 cDNA ORF Clone, Human, untagged HG13066-UT
    GOLPH2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13066-ACGLN
    GOLPH2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13066-ACG
    GOLPH2 cDNA ORF Clone, Human, N-GFPSpark® tag HG13066-ANG
    GOLPH2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13066-ACR
    GOLPH2 cDNA ORF Clone, Human, N-OFPSpark® tag HG13066-ANR
    GOLPH2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13066-CF
    GOLPH2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13066-NF
    GOLPH2 cDNA ORF Clone, Human, C-His tag HG13066-CH
    GOLPH2 cDNA ORF Clone, Human, C-HA tag HG13066-CY
    GOLPH2 cDNA ORF Clone, Human, N-HA tag HG13066-NY
    GOLPH2 cDNA ORF Clone, Human, C-Myc tag HG13066-CM
    GOLPH2 cDNA ORF Clone, Human, N-Myc tag HG13066-NM
    GOLPH2 qPCR Primer Pairs, Human HP100020
    info info
    添加购物车成功! 添加购物车失败!