GNS cDNA ORF Clone, Human, N-Myc tag

Cat: HG10319-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GNS Reagents
CRO Services
Product recommended

All GNS Reagents
GNS cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1659 bp
Description
Full length Clone DNA of Human glucosamine (N-acetyl)-6-sulfatase with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GNS cDNA ORF Clone, Human, N-Myc tag Alternative Names
G6S cDNA ORF Clone, Human
GNS Background Information

Glucosamine (N-acetyl)-6-sulfatase (GNS), also known as G6S, a hydrolase, which is one of the enzymes involved in heparan sulfate catabolism leading to lysosomal storage. GNS is required for the catabolism of the glycosaminoglycans (GAG) including heparin, heparan sulphate, and keratan sulphate through the hydrolysis of 6-sulfate group from the N-acetyl-D-glucosamine 6-sulfate units. Mucopolysaccharidosis type IIID (MPS IIID) is the least common of the four subtypes of Sanfilippo syndrome. It is caused by a deficiency of N-acetylglucosamine-6-sulphatase. A mutation in GNS resulting in MPS IIID indicates the potential utility of molecular diagnosis for this rare condition. As the least common type of the four subtypes of Sanfilippo syndrome, MPS IIID has profound mental deterioration, hyperactivity, and relatively mild somatic manifestations.

Full Name
glucosamine (N-acetyl)-6-sulfatase
References
  • Fuchs W, et al. (1985) Intralysosomal formation and metabolic fate of N-acetylglucosamine 6-sulfate from keratan sulfate. Eur J Biochem. 151(3): 551-6.
  • Beesley CE, et al. (2003) Sanfilippo syndrome type D: identification of the first mutation in the N-acetylglucosamine-6-sulphatase gene. J Med Genet. 40(3): 192-4.
  • Mok A, et al. (2003) Genomic basis of mucopolysaccharidosis type IIID (MIM 252940) revealed by sequencing of GNS encoding N-acetylglucosamine-6-sulfatase. Genomics. 81(1): 1-5.
  • Elioglu NH, et al. (2009) A novel loss-of-function mutation in the GNS gene causes Sanfilippo syndrome type D. Genet Couns. 20(2): 133-9.
  • info info
    添加购物车成功! 添加购物车失败!