After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human Glucosamine (N-acetyl)-6-Sulfatase Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human GNS cDNA Clone Product Information
NCBI RefSeq:NM_002076.3
RefSeq ORF Size:1659bp
cDNA Description:Full length Clone DNA of Homo sapiens glucosamine (N-acetyl)-6-sulfatase with N terminal Myc tag.
Gene Synonym:G6S, MGC21274
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Glucosamine (N-acetyl)-6-sulfatase (GNS), also known as G6S, a hydrolase, which is one of the enzymes involved in heparan sulfate catabolism leading to lysosomal storage. GNS is required for the catabolism of the glycosaminoglycans (GAG) including heparin, heparan sulphate, and keratan sulphate through the hydrolysis of 6-sulfate group from the N-acetyl-D-glucosamine 6-sulfate units. Mucopolysaccharidosis type IIID (MPS IIID) is the least common of the four subtypes of Sanfilippo syndrome. It is caused by a deficiency of N-acetylglucosamine-6-sulphatase. A mutation in GNS resulting in MPS IIID indicates the potential utility of molecular diagnosis for this rare condition. As the least common type of the four subtypes of Sanfilippo syndrome, MPS IIID has profound mental deterioration, hyperactivity, and relatively mild somatic manifestations.

References
  • Fuchs W, et al. (1985) Intralysosomal formation and metabolic fate of N-acetylglucosamine 6-sulfate from keratan sulfate. Eur J Biochem. 151(3): 551-6.
  • Beesley CE, et al. (2003) Sanfilippo syndrome type D: identification of the first mutation in the N-acetylglucosamine-6-sulphatase gene. J Med Genet. 40(3): 192-4.
  • Mok A, et al. (2003) Genomic basis of mucopolysaccharidosis type IIID (MIM 252940) revealed by sequencing of GNS encoding N-acetylglucosamine-6-sulfatase. Genomics. 81(1): 1-5.
  • Elioglu NH, et al. (2009) A novel loss-of-function mutation in the GNS gene causes Sanfilippo syndrome type D. Genet Couns. 20(2): 133-9.
  • Size / Price
    Catalog: HG10319-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"