GNG13 cDNA ORF Clone, Human, N-His tag

Cat: HG13173-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GNG13 Reagents
CRO Services
Product recommended

All GNG13 Reagents
GNG13 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
204 bp
Description
Full length Clone DNA of Human guanine nucleotide binding protein (G protein), gamma 13 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GNG13 cDNA ORF Clone, Human, N-His tag Alternative Names
G(gamma)13 cDNA ORF Clone, Human;h2-35 cDNA ORF Clone, Human
GNG13 Background Information

GNG13 is a subunit of heterotrimeric G proteins which consist of alpha, beta, and gamma subunits. Heterotrimeric G proteins are membrane bound GTPases that are linked to 7-TM receptors. They function as signal transducers for the 7-transmembrane-helix G protein-coupled receptors. They are involved as a modulator or transducer in various transmembrane signaling systems. Each G protein is composed of an alpha-, beta- and gamma-subunit and is bound to GDP in the 'off' state. Ligand-receptor binding results in detachment of the G protein, switching it to an 'on' state and permitting Galpha activation of second messenger signalling cascades. There are several types of Galpha proteins; in addition, some Gbetagamma subunits have active functions. Gbetagamma coupled to H1 receptors can activate PLA2 and Gbetagamma coupled to M1 receptors can activate KIR channels. The beta and gamma chains are required for the GTPase activity, for replacement of GDP by GTP, and for G protein-effector interaction. GNG13 is a gamma subunit that is expressed in taste, retinal, and neuronal tissues and plays a key role in taste transduction.

Full Name
guanine nucleotide binding protein (G protein), gamma 13
References
  • Huang L, et al. (2000) Ggamma13 colocalizes with gustducin in taste receptor cells and mediates IP3 responses to bitter denatonium. Nat Neurosci. 2 (12): 1055-62.
  • Blake B L, et al. (2001) G beta association and effector interaction selectivities of the divergent G gamma subunit G gamma(13). J Biol Chem. 276 (52): 49267-74.
  • Bonaldo MF, et al. (1997) Normalization and subtraction: two approaches to facilitate gene discovery. Genome Res. 6 (9): 791-806.
  • info info
    添加购物车成功! 添加购物车失败!