GNAI3 cDNA ORF Clone, Human, C-His tag

Cat: HG16381-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GNAI3 Reagents
CRO Services
Product recommended

All GNAI3 Reagents
GNAI3 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1065 bp
Description
Full length Clone DNA of Human guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GNAI3 cDNA ORF Clone, Human, C-His tag Alternative Names
87U6 cDNA ORF Clone, Human;ARCND1 cDNA ORF Clone, Human
GNAI3 Background Information
Full Name
guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3

GNAI3 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
GNAI3 cDNA ORF Clone in Cloning Vector, Rhesus CG90757-G
GNAI3 cDNA ORF Clone, Rhesus, untagged CG90757-UT
GNAI3 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90757-ACG
GNAI3 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90757-ACGLN
GNAI3 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90757-ANG
GNAI3 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90757-ACR
GNAI3 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90757-ANR
GNAI3 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90757-CF
GNAI3 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90757-NF
GNAI3 cDNA ORF Clone, Rhesus, C-His tag CG90757-CH
GNAI3 cDNA ORF Clone, Rhesus, N-His tag CG90757-NH
GNAI3 cDNA ORF Clone, Rhesus, C-HA tag CG90757-CY
GNAI3 cDNA ORF Clone, Rhesus, N-HA tag CG90757-NY
GNAI3 cDNA ORF Clone, Rhesus, C-Myc tag CG90757-CM
GNAI3 cDNA ORF Clone, Rhesus, N-Myc tag CG90757-NM

GNAI3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GNAI3 cDNA ORF Clone in Cloning Vector, Mouse MG52612-G
GNAI3 cDNA ORF Clone, Mouse, untagged MG52612-UT
GNAI3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52612-ACGLN
GNAI3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52612-ACG
GNAI3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52612-ANG
GNAI3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52612-ACR
GNAI3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52612-ANR
GNAI3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52612-CF
GNAI3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52612-NF
GNAI3 cDNA ORF Clone, Mouse, C-His tag MG52612-CH
GNAI3 cDNA ORF Clone, Mouse, N-His tag MG52612-NH
GNAI3 cDNA ORF Clone, Mouse, C-HA tag MG52612-CY
GNAI3 cDNA ORF Clone, Mouse, N-HA tag MG52612-NY
GNAI3 cDNA ORF Clone, Mouse, C-Myc tag MG52612-CM
GNAI3 cDNA ORF Clone, Mouse, N-Myc tag MG52612-NM
GNAI3 qPCR Primer Pairs, Mouse MP202483

GNAI3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GNAI3 cDNA ORF Clone in Cloning Vector, Human HG16381-G
GNAI3 cDNA ORF Clone, Human, untagged HG16381-UT
GNAI3 cDNA ORF Clone, Human, C-GFPSpark® tag HG16381-ACG
GNAI3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16381-ACGLN
GNAI3 cDNA ORF Clone, Human, N-GFPSpark® tag HG16381-ANG
GNAI3 cDNA ORF Clone, Human, C-OFPSpark® tag HG16381-ACR
GNAI3 cDNA ORF Clone, Human, N-OFPSpark® tag HG16381-ANR
GNAI3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16381-CF
GNAI3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16381-NF
GNAI3 cDNA ORF Clone, Human, N-His tag HG16381-NH
GNAI3 cDNA ORF Clone, Human, C-HA tag HG16381-CY
GNAI3 cDNA ORF Clone, Human, N-HA tag HG16381-NY
GNAI3 cDNA ORF Clone, Human, C-Myc tag HG16381-CM
GNAI3 cDNA ORF Clone, Human, N-Myc tag HG16381-NM
GNAI3 qPCR Primer Pairs, Human HP105130
info info
添加购物车成功! 添加购物车失败!