GNA11 cDNA ORF Clone, Human, C-HA tag

Cat: HG15842-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GNA11 Reagents
CRO Services
Product recommended

All GNA11 Reagents
GNA11 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1080 bp
Description
Full length Clone DNA of Human guanine nucleotide binding protein (G protein), alpha 11 (Gq class) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GNA11 cDNA ORF Clone, Human, C-HA tag Alternative Names
FBH cDNA ORF Clone, Human;FBH2 cDNA ORF Clone, Human;FHH2 cDNA ORF Clone, Human;GNA-11 cDNA ORF Clone, Human;HHC2 cDNA ORF Clone, Human;HYPOC2 cDNA ORF Clone, Human
GNA11 Background Information
Full Name
guanine nucleotide binding protein (G protein), alpha 11 (Gq class)

GNA11 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GNA11 cDNA ORF Clone in Cloning Vector, Mouse MG52403-G
GNA11 cDNA ORF Clone, Mouse, untagged MG52403-UT
GNA11 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52403-ACGLN
GNA11 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52403-ACG
GNA11 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52403-ANG
GNA11 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52403-ACR
GNA11 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52403-ANR
GNA11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52403-CF
GNA11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52403-NF
GNA11 cDNA ORF Clone, Mouse, C-His tag MG52403-CH
GNA11 cDNA ORF Clone, Mouse, N-His tag MG52403-NH
GNA11 cDNA ORF Clone, Mouse, C-HA tag MG52403-CY
GNA11 cDNA ORF Clone, Mouse, N-HA tag MG52403-NY
GNA11 cDNA ORF Clone, Mouse, C-Myc tag MG52403-CM
GNA11 cDNA ORF Clone, Mouse, N-Myc tag MG52403-NM
GNA11 qPCR Primer Pairs, Mouse MP202276

GNA11 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GNA11 cDNA ORF Clone in Cloning Vector, Human HG15842-G
GNA11 cDNA ORF Clone, Human, untagged HG15842-UT
GNA11 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15842-ACGLN
GNA11 cDNA ORF Clone, Human, C-GFPSpark® tag HG15842-ACG
GNA11 cDNA ORF Clone, Human, C-OFPSpark® tag HG15842-ACR
GNA11 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15842-CF
GNA11 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15842-NF
GNA11 cDNA ORF Clone, Human, C-His tag HG15842-CH
GNA11 cDNA ORF Clone, Human, N-His tag HG15842-NH
GNA11 cDNA ORF Clone, Human, N-HA tag HG15842-NY
GNA11 cDNA ORF Clone, Human, C-Myc tag HG15842-CM
GNA11 cDNA ORF Clone, Human, N-Myc tag HG15842-NM
GNA11 qPCR Primer Pairs, Human HP104433
info info
添加购物车成功! 添加购物车失败!