GMPR cDNA ORF Clone, Human, N-Myc tag

Cat: HG15487-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GMPR Reagents
CRO Services
Product recommended

All GMPR Reagents
GMPR cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1038 bp
Description
Full length Clone DNA of Human guanosine monophosphate reductase with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GMPR cDNA ORF Clone, Human, N-Myc tag Alternative Names
GMPR1 cDNA ORF Clone, Human
GMPR Background Information

GMPR, also known as GMPR1, belongs to the IMPDH/GMPR family. This family of enzymes includes IMP dehydrogenase and GMP reductase. These enzymes are involved in purine metabolism and adopt a TIM barrel structure. GMPR is an enzyme that catalyzes the irreversible and NADPH-dependent reductive deamination of GMP to IMP. GMPR functions in the conversion of nucleobase, nucleoside and nucleotide derivatives of G to A nucleotides, and in maintaining the intracellular balance of A and G nucleotides.

Full Name
guanosine monophosphate reductase
References
  • Deng Y., et al.,(2002), NADPH-dependent GMP reductase isoenzyme of human (GMPR2). Expression, purification, and kinetic properties. Int. J. Biochem. Cell Biol. 34:1035-1050.
  • Zhang J., et al., (2003), Cloning and functional characterization of GMPR2, a novel human guanosine monophosphate reductase, which promotes the monocytic differentiation of HL-60 leukemia cells.J. Cancer Res. Clin. Oncol. 129:76-83.
  • Ivens A.C., et al.,(2005), The genome of the kinetoplastid parasite, Leishmania major.Science 309:436-442.
  • GMPR cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    GMPR cDNA ORF Clone in Cloning Vector, Rat RG87796-U
    GMPR Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG87796-ACGLN

    GMPR cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    GMPR cDNA ORF Clone in Cloning Vector, Mouse MG51395-U
    GMPR cDNA ORF Clone, Mouse, untagged MG51395-UT
    GMPR cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51395-ACG
    GMPR Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51395-ACGLN
    GMPR cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51395-ANG
    GMPR cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51395-ACR
    GMPR cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51395-ANR
    GMPR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51395-CF
    GMPR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51395-NF
    GMPR cDNA ORF Clone, Mouse, C-His tag MG51395-CH
    GMPR cDNA ORF Clone, Mouse, N-His tag MG51395-NH
    GMPR cDNA ORF Clone, Mouse, C-HA tag MG51395-CY
    GMPR cDNA ORF Clone, Mouse, N-HA tag MG51395-NY
    GMPR cDNA ORF Clone, Mouse, C-Myc tag MG51395-CM
    GMPR cDNA ORF Clone, Mouse, N-Myc tag MG51395-NM
    GMPR qPCR Primer Pairs, Mouse MP201265

    GMPR cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GMPR cDNA ORF Clone in Cloning Vector, Human HG15487-G
    GMPR cDNA ORF Clone, Human, untagged HG15487-UT
    GMPR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15487-ACGLN
    GMPR cDNA ORF Clone, Human, C-GFPSpark® tag HG15487-ACG
    GMPR cDNA ORF Clone, Human, N-GFPSpark® tag HG15487-ANG
    GMPR cDNA ORF Clone, Human, C-OFPSpark® tag HG15487-ACR
    GMPR cDNA ORF Clone, Human, N-OFPSpark® tag HG15487-ANR
    GMPR cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15487-CF
    GMPR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15487-NF
    GMPR cDNA ORF Clone, Human, C-His tag HG15487-CH
    GMPR cDNA ORF Clone, Human, N-His tag HG15487-NH
    GMPR cDNA ORF Clone, Human, C-HA tag HG15487-CY
    GMPR cDNA ORF Clone, Human, N-HA tag HG15487-NY
    GMPR cDNA ORF Clone, Human, C-Myc tag HG15487-CM
    GMPR qPCR Primer Pairs, Human HP104109
    info info
    添加购物车成功! 添加购物车失败!