GMPPB cDNA ORF Clone, Human, N-His tag

Cat: HG14404-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All GMPPB Reagents
CRO Services
Product recommended

All GMPPB Reagents
GMPPB cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1083 bp
Description
Full length Clone DNA of Human GDP-mannose pyrophosphorylase B with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GMPPB cDNA ORF Clone, Human, N-His tag Alternative Names
MDDGA14 cDNA ORF Clone, Human;MDDGB14 cDNA ORF Clone, Human;MDDGC14 cDNA ORF Clone, Human
GMPPB Background Information
Full Name
GDP-mannose pyrophosphorylase B

GMPPB cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GMPPB cDNA ORF Clone in Cloning Vector, Mouse MG54419-U
GMPPB cDNA ORF Clone, Mouse, untagged MG54419-UT
GMPPB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54419-ACGLN
GMPPB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54419-ACG
GMPPB cDNA ORF Clone, Mouse, N-GFPSpark® tag MG54419-ANG
GMPPB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG54419-ACR
GMPPB cDNA ORF Clone, Mouse, N-OFPSpark® tag MG54419-ANR
GMPPB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG54419-CF
GMPPB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG54419-NF
GMPPB cDNA ORF Clone, Mouse, C-His tag MG54419-CH
GMPPB cDNA ORF Clone, Mouse, N-His tag MG54419-NH
GMPPB cDNA ORF Clone, Mouse, C-HA tag MG54419-CY
GMPPB cDNA ORF Clone, Mouse, N-HA tag MG54419-NY
GMPPB cDNA ORF Clone, Mouse, C-Myc tag MG54419-CM
GMPPB cDNA ORF Clone, Mouse, N-Myc tag MG54419-NM

GMPPB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GMPPB cDNA ORF Clone in Cloning Vector, Human HG14404-G
GMPPB cDNA ORF Clone, Human, untagged HG14404-UT
GMPPB cDNA ORF Clone, Human, C-GFPSpark® tag HG14404-ACG
GMPPB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14404-ACGLN
GMPPB cDNA ORF Clone, Human, N-GFPSpark® tag HG14404-ANG
GMPPB cDNA ORF Clone, Human, C-OFPSpark® tag HG14404-ACR
GMPPB cDNA ORF Clone, Human, N-OFPSpark® tag HG14404-ANR
GMPPB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14404-CF
GMPPB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14404-NF
GMPPB cDNA ORF Clone, Human, C-His tag HG14404-CH
GMPPB cDNA ORF Clone, Human, C-HA tag HG14404-CY
GMPPB cDNA ORF Clone, Human, N-HA tag HG14404-NY
GMPPB cDNA ORF Clone, Human, C-Myc tag HG14404-CM
GMPPB cDNA ORF Clone, Human, N-Myc tag HG14404-NM
GMPPB qPCR Primer Pairs, Human HP103053
info info
添加购物车成功! 添加购物车失败!