Quick Order

Human GMFB Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human GMFB cDNA Clone Product Information
NCBI RefSeq:BC005359
RefSeq ORF Size:465bp
cDNA Description:Full length Clone DNA of Homo sapiens glia maturation factor, beta with N terminal Myc tag.
Gene Synonym:GMF, GMFB
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

GMFB is a nerve growth factor which belongs to the actin-binding proteins ADF family, GMF subfamily. GMFB is involved in nervous system development, angiogenesis and immune function. It is especially crucial for the nervous system. GMFB causes brain cell differentiation, stimulates neural regeneration and inhibits tumor cell proliferation. It contains 1 ADF-H domain and is phosphorylated after phorbol ester stimulation. GMFB overexpression in astrocytes results in the increase of BDNF production. GMFB expression is increased by exercise, thus BDNF is important for exercise-induction of BDNF.

References
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Zaheer S, et al. (2011) Augmented expression of glia maturation factor in Alzheimer's disease. Neuroscience. 194:227-33.
  • Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • Size / Price
    Catalog: HG13244-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"