Quick Order

Human glutaredoxin-1 / GRX1 / GLRX Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human GLRX cDNA Clone Product Information
NCBI RefSeq:BC005304
RefSeq ORF Size:321bp
cDNA Description:Full length Clone DNA of Homo sapiens glutaredoxin (thioltransferase).
Gene Synonym:GRX, GRX1
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Glutaredoxin-1, also known as GRX1 and GLRX, belongs to the glutaredoxin family. Glutaredoxins are small redox enzymes that use glutathione as a cofactor. Glutaredoxins are oxidized by substrates, and reduced non-enzymatically by glutathione. Glutaredoxin-1 functions as an electron carrier in the glutathione-dependent synthesis of deoxyribonucleotides by the enzyme ribonucleotide reductase. Glutaredoxin-1 exists in either a reduced or an oxidized form. Glutaredoxins function as electron carriers in the glutathione-dependent synthesis of deoxyribonucleotides by the enzymeribonucleotide reductase.

References
  • Holmgren A. et al., 1988, FEMS Microbiol Rev. 4 (4): 271-97.
  • Holmgren A. 1988, Biochem Soc Trans. 16 (2): 95-6.
  • Holmgren A. 1989, J Biol Chem. 264 (24): 13963-6.
  • Size / Price
    Catalog: HG14484-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"