GLMN/Glomulin cDNA ORF Clone, Human, C-Myc tag

Cat: HG11354-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GLMN/Glomulin Reagents
CRO Services
Product recommended

All GLMN/Glomulin Reagents
GLMN/Glomulin cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1785 bp
Description
Full length Clone DNA of Human glomulin, FKBP associated protein with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GLMN/Glomulin cDNA ORF Clone, Human, C-Myc tag Alternative Names
FAP cDNA ORF Clone, Human;FAP48 cDNA ORF Clone, Human;FAP68 cDNA ORF Clone, Human;FKBPAP cDNA ORF Clone, Human;GLML cDNA ORF Clone, Human;GVM cDNA ORF Clone, Human;VMGLOM cDNA ORF Clone, Human
GLMN/Glomulin Background Information
Full Name
glomulin, FKBP associated protein

GLMN/Glomulin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GLMN/Glomulin cDNA ORF Clone in Cloning Vector, Mouse MG5A3898-U
GLMN/Glomulin cDNA ORF Clone, Mouse, untagged MG5A3898-UT
GLMN/Glomulin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3898-ACG
GLMN/Glomulin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3898-ACGLN
GLMN/Glomulin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A3898-ANG
GLMN/Glomulin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A3898-ACR
GLMN/Glomulin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A3898-ANR
GLMN/Glomulin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A3898-CF
GLMN/Glomulin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A3898-NF
GLMN/Glomulin cDNA ORF Clone, Mouse, C-His tag MG5A3898-CH
GLMN/Glomulin cDNA ORF Clone, Mouse, N-His tag MG5A3898-NH
GLMN/Glomulin cDNA ORF Clone, Mouse, C-HA tag MG5A3898-CY
GLMN/Glomulin cDNA ORF Clone, Mouse, N-HA tag MG5A3898-NY
GLMN/Glomulin cDNA ORF Clone, Mouse, C-Myc tag MG5A3898-CM
GLMN/Glomulin cDNA ORF Clone, Mouse, N-Myc tag MG5A3898-NM

GLMN/Glomulin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GLMN/Glomulin cDNA ORF Clone in Cloning Vector, Human HG11354-M
GLMN/Glomulin cDNA ORF Clone, Human, untagged HG11354-UT
GLMN/Glomulin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11354-ACGLN
GLMN/Glomulin cDNA ORF Clone, Human, C-GFPSpark® tag HG11354-ACG
GLMN/Glomulin cDNA ORF Clone, Human, N-GFPSpark® tag HG11354-ANG
GLMN/Glomulin cDNA ORF Clone, Human, C-OFPSpark® tag HG11354-ACR
GLMN/Glomulin cDNA ORF Clone, Human, N-OFPSpark® tag HG11354-ANR
GLMN/Glomulin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11354-CF
GLMN/Glomulin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11354-NF
GLMN/Glomulin cDNA ORF Clone, Human, C-His tag HG11354-CH
GLMN/Glomulin cDNA ORF Clone, Human, N-His tag HG11354-NH
GLMN/Glomulin cDNA ORF Clone, Human, C-HA tag HG11354-CY
GLMN/Glomulin cDNA ORF Clone, Human, N-HA tag HG11354-NY
GLMN/Glomulin cDNA ORF Clone, Human, N-Myc tag HG11354-NM
GLMN/Glomulin qPCR Primer Pairs, Human HP101239
info info
添加购物车成功! 添加购物车失败!