GLIPR1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10873-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GLIPR1 Reagents
CRO Services
Product recommended

All GLIPR1 Reagents
GLIPR1 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
801 bp
Description
Full length Clone DNA of Human GLI pathogenesis-related 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GLIPR1 cDNA ORF Clone, Human, N-Myc tag Alternative Names
CRISP7 cDNA ORF Clone, Human;GLIPR cDNA ORF Clone, Human;RTVP1 cDNA ORF Clone, Human
GLIPR1 Background Information

Glioma pathogenesis-related protein 1, also known as Protein RTVP-1, GLIPR1 and GLIPR, is a single-pass membrane protein which belongs to the CRISP family. GLIPR1 / RTVP-1 was expressed in high levels in glioblastomas, whereas its expression in low-grade astrocytomas and normal brains was very low. Transfection of glioma cells with small interfering RNAs targeting GLIPR1 / RTVP-1 decreased cell proliferation in all the cell lines examined and induced cell apoptosis in some of them. Overexpression of GLIPR1 / RTVP-1 increased astrocyte and glioma cell proliferation and the anchorage-independent growth of the cells. In addition, overexpression of GLIPR1 / RTVP-1 rendered glioma cells more resistant to the apoptotic effect of tumor necrosis factor-related apoptosis-inducing ligand and serum deprivation. GLIPR1 / RTVP-1 regulated the invasion of glioma cells was evident by their enhanced migration through Matrigel and by their increased invasion in a spheroid confrontation assay. The increased invasive potential of the GLIPR1 / RTVP-1 overexpressors was also shown by the increased activity of matrix metalloproteinase 2 in these cells. The expression of GLIPR1 / RTVP-1 is correlated with the degree of malignancy of astrocytic tumors and that GLIPR1 / RTVP-1 is involved in the regulation of the growth, survival, and invasion of glioma cells. GLIPR1 / RTVP-1 is a potential therapeutic target in gliomas.

Full Name
GLI pathogenesis-related 1
References
  • Murphy E.V., et al., 1995, Gene. 159:131-5.
  • Rich T., et al., 1996, Gene. 180:125-30.
  • Rosenzweig,T. et al., 2006, Cancer Res. 66 (8):4139-48.
  • GLIPR1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    GLIPR1 cDNA ORF Clone in Cloning Vector, Mouse MG50869-G
    GLIPR1 cDNA ORF Clone, Mouse, untagged MG50869-UT
    GLIPR1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50869-ACGLN
    GLIPR1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50869-ACG
    GLIPR1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50869-ACR
    GLIPR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50869-CF
    GLIPR1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50869-NF
    GLIPR1 cDNA ORF Clone, Mouse, C-His tag MG50869-CH
    GLIPR1 cDNA ORF Clone, Mouse, N-His tag MG50869-NH
    GLIPR1 cDNA ORF Clone, Mouse, C-HA tag MG50869-CY
    GLIPR1 cDNA ORF Clone, Mouse, N-HA tag MG50869-NY
    GLIPR1 cDNA ORF Clone, Mouse, C-Myc tag MG50869-CM
    GLIPR1 cDNA ORF Clone, Mouse, N-Myc tag MG50869-NM
    GLIPR1 qPCR Primer Pairs, Mouse MP200840

    GLIPR1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GLIPR1 cDNA ORF Clone in Cloning Vector, Human HG10873-M
    GLIPR1 cDNA ORF Clone, Human, untagged HG10873-UT
    GLIPR1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10873-ACG
    GLIPR1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10873-ACGLN
    GLIPR1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10873-ACR
    GLIPR1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10873-CF
    GLIPR1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10873-NF
    GLIPR1 cDNA ORF Clone, Human, C-His tag HG10873-CH
    GLIPR1 cDNA ORF Clone, Human, N-His tag HG10873-NH
    GLIPR1 cDNA ORF Clone, Human, C-HA tag HG10873-CY
    GLIPR1 cDNA ORF Clone, Human, N-HA tag HG10873-NY
    GLIPR1 cDNA ORF Clone, Human, C-Myc tag HG10873-CM
    GLIPR1 qPCR Primer Pairs, Human HP100760
    info info
    添加购物车成功! 添加购物车失败!