Quick Order

Text Size:AAA

Human GLA natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human GLA cDNA Clone Product Information
NCBI RefSeq:NM_000169.2
RefSeq ORF Size:1290bp
cDNA Description:Full length Clone DNA of Homo sapiens galactosidase, alpha.
Gene Synonym:GALA
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-GLA
Restriction Site:HindIII + XbaI (6.1kb + 1.29kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human GLA Gene Plasmid Map
Human GLA Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Alpha-galactosidase A, also known as Alpha-D-galactoside galactohydrolase, Alpha-D-galactosidase A, Melibiase and GLA, is a member of the glycosyl hydrolase 27 family. GLA is used as a long-term enzyme replacement therapy in patients with a confirmed diagnosis of Fabry disease. Defects in GLA are the cause of Fabry disease (FD) which is a rare X-linked sphingolipidosis disease where glycolipid accumulates in many tissues. The disease consists of an inborn error of glycosphingolipid catabolism. FD patients show systemic accumulation of globotriaoslyceramide (Gb3) and related glycosphingolipids in the plasma and cellular lysosomes throughout the body. Clinical recognition in males results from characteristic skin lesions (angiokeratomas) over the lower trunk. Patients may show ocular deposits, febrile episodes, and burning pain in the extremities. Death results from renal failure, cardiac or cerebral complications of hypertension or other vascular disease. Deficiency of GLA leads to the accumulation of glycosphingolipids in the vasculature leading to multiorgan pathology. In addition to well-described microvascular disease, deficiency of GLA is also characterized by premature macrovascular events such as stroke and possibly myocardial infarction.

References
  • Koide T.et al., 1990, FEBS Lett. 259:353-356.
  • Yang C.-C. et al., 2003, Clin. Genet. 63:205-209.
  • Verovnik F. et al.,2004, Eur. J. Hum. Genet. 12:678-681.
  • Nance C.S. et al., 2006, Arch. Neurol. 63:453-457.
  • Size / Price
    Catalog: HG12078-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"