GHRH cDNA ORF Clone, Human, N-Myc tag

Cat: HG15602-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All GHRH Reagents
CRO Services
Product recommended

All GHRH Reagents
GHRH cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
324 bp
Description
Full length Clone DNA of Human growth hormone releasing hormone with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GHRH cDNA ORF Clone, Human, N-Myc tag Alternative Names
GHRF cDNA ORF Clone, Human;GRF cDNA ORF Clone, Human;INN cDNA ORF Clone, Human
GHRH Background Information
Full Name
growth hormone releasing hormone

GHRH cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GHRH cDNA ORF Clone in Cloning Vector, Mouse MG53183-G
GHRH cDNA ORF Clone, Mouse, untagged MG53183-UT
GHRH Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53183-ACGLN
GHRH cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53183-ACG
GHRH cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53183-ACR
GHRH cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53183-CF
GHRH cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53183-NF
GHRH cDNA ORF Clone, Mouse, C-His tag MG53183-CH
GHRH cDNA ORF Clone, Mouse, N-His tag MG53183-NH
GHRH cDNA ORF Clone, Mouse, C-HA tag MG53183-CY
GHRH cDNA ORF Clone, Mouse, N-HA tag MG53183-NY
GHRH cDNA ORF Clone, Mouse, C-Myc tag MG53183-CM
GHRH cDNA ORF Clone, Mouse, N-Myc tag MG53183-NM

GHRH cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GHRH cDNA ORF Clone in Cloning Vector, Human HG15602-G
GHRH cDNA ORF Clone, Human, untagged HG15602-UT
GHRH Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15602-ACGLN
GHRH cDNA ORF Clone, Human, C-GFPSpark® tag HG15602-ACG
GHRH cDNA ORF Clone, Human, C-OFPSpark® tag HG15602-ACR
GHRH cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15602-CF
GHRH cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15602-NF
GHRH cDNA ORF Clone, Human, C-His tag HG15602-CH
GHRH cDNA ORF Clone, Human, N-His tag HG15602-NH
GHRH cDNA ORF Clone, Human, C-HA tag HG15602-CY
GHRH cDNA ORF Clone, Human, N-HA tag HG15602-NY
GHRH cDNA ORF Clone, Human, C-Myc tag HG15602-CM
GHRH qPCR Primer Pairs, Human HP104222
info info
添加购物车成功! 添加购物车失败!