GGCT cDNA ORF Clone, Human, N-His tag

Cat: HG14366-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All GGCT Reagents
CRO Services
Product recommended

All GGCT Reagents
GGCT cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
567 bp
Description
Full length Clone DNA of Human gamma-glutamylcyclotransferase with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GGCT cDNA ORF Clone, Human, N-His tag Alternative Names
C7orf24 cDNA ORF Clone, Human;CRF21 cDNA ORF Clone, Human;GCTG cDNA ORF Clone, Human;GGC cDNA ORF Clone, Human
GGCT Background Information

GGCT belongs to the gamma-glutamylcyclotransferase family. It catalyzes the formation of 5-oxoproline from gamma-glutamyl dipeptides, the penultimate step in glutathione catabolism. GGCT may play a significant role in glutathione homeostasis. GGCT also induces release of cytochrome c from mitochondria with resultant induction of apoptosis. Pseudogenes of GGCT gene are located on the long arm of chromosome 5 and the short arm of chromosomes 2 and 20. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Full Name
gamma-glutamylcyclotransferase
References
  • Wagner SA. et al., 2011, Mol Cell Proteomics. 10 (10): M111.013284.
  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Amano T. et al., 2012, J Histochem Cytochem. 60 (1): 76-86.
  • GGCT cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    GGCT cDNA ORF Clone in Cloning Vector, Rhesus CG90618-G
    GGCT cDNA ORF Clone, Rhesus, untagged CG90618-UT
    GGCT cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90618-ACG
    GGCT Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90618-ACGLN
    GGCT cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90618-ANG
    GGCT cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90618-ACR
    GGCT cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90618-ANR
    GGCT cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90618-CF
    GGCT cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90618-NF
    GGCT cDNA ORF Clone, Rhesus, C-His tag CG90618-CH
    GGCT cDNA ORF Clone, Rhesus, N-His tag CG90618-NH
    GGCT cDNA ORF Clone, Rhesus, C-HA tag CG90618-CY
    GGCT cDNA ORF Clone, Rhesus, N-HA tag CG90618-NY
    GGCT cDNA ORF Clone, Rhesus, C-Myc tag CG90618-CM
    GGCT cDNA ORF Clone, Rhesus, N-Myc tag CG90618-NM

    GGCT cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GGCT cDNA ORF Clone in Cloning Vector, Human HG14366-G
    GGCT cDNA ORF Clone, Human, untagged HG14366-UT
    GGCT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14366-ACGLN
    GGCT cDNA ORF Clone, Human, C-GFPSpark® tag HG14366-ACG
    GGCT cDNA ORF Clone, Human, N-GFPSpark® tag HG14366-ANG
    GGCT cDNA ORF Clone, Human, C-OFPSpark® tag HG14366-ACR
    GGCT cDNA ORF Clone, Human, N-OFPSpark® tag HG14366-ANR
    GGCT cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14366-CF
    GGCT cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14366-NF
    GGCT cDNA ORF Clone, Human, C-His tag HG14366-CH
    GGCT cDNA ORF Clone, Human, C-HA tag HG14366-CY
    GGCT cDNA ORF Clone, Human, N-HA tag HG14366-NY
    GGCT cDNA ORF Clone, Human, C-Myc tag HG14366-CM
    GGCT cDNA ORF Clone, Human, N-Myc tag HG14366-NM
    GGCT qPCR Primer Pairs, Human HP103015
    info info
    添加购物车成功! 添加购物车失败!