GFPT1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11071-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GFPT1 Reagents
CRO Services
Product recommended

All GFPT1 Reagents
GFPT1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2046 bp
Description
Full length Clone DNA of Human glutamine-fructose-6-phosphate transaminase 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GFPT1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CMSTA1 cDNA ORF Clone, Human;GFA cDNA ORF Clone, Human;GFAT cDNA ORF Clone, Human;GFAT1 cDNA ORF Clone, Human;GFAT1m cDNA ORF Clone, Human;GFPT cDNA ORF Clone, Human;GFPT1L cDNA ORF Clone, Human;MSLG cDNA ORF Clone, Human
GFPT1 Background Information

Glutamine:fructose-6-phosphate amidotransferase 1 (GFAT), also known as GFPT1, is a member of the N-terminal nucleophile aminotransferases and the first rate-limiting enzyme for the entry of glucose into the hexosamine biosynthesis pathway (HBP) in mammals. GFAT transfers the amino group from the L-glutamine amide to the D-fructose 6-phosphate, producing glutamic acid and glucosamine 6-phosphate. GFAT exists as a homotetramer in cytoplasm, and is proposed to be most likely involved in regulating the availability of precursors for N- and O-linked glycosylation of proteins. The full length of human GFAT contains 1 glutamine amidotransferase type-2 domain which catalyzes amide nitrogen transfer from glutamine to the appropriate substrate, and 2 SIS (Sugar Isomerase) domains found in many phosphosugar isomerases and phosphosugar binding proteins.Two isoforms of gfat have been identified: GFAT1 is predominantly expressed in skeletal muscle, whereas GFAT2 is expressed mainly in the central nervous system.

Full Name
glutamine--fructose-6-phosphate transaminase 1
References
  • McKnight G.L., et al.,(1992), Molecular cloning, cDNA sequence, and bacterial expression of human glutamine:fructose-6-phosphate amidotransferase. J. Biol. Chem. 267:25208-25212.
  • Hillier L.W., et al., (2005), Generation and annotation of the DNA sequences of human chromosomes 2 and 4.Nature 434:724-731.
  • Beausoleil S.A., et al.,(2006), A probability-based approach for high-throughput protein phosphorylation analysis and site localization. Nat. Biotechnol. 24:1285-1292.
  • info info
    添加购物车成功! 添加购物车失败!