Text Size:AAA

Human GFPT1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human GFPT1 cDNA Clone Product Information
NCBI RefSeq:NM_002056.2
RefSeq ORF Size:2046bp
cDNA Description:Full length Clone DNA of Homo sapiens glutamine-fructose-6-phosphate transaminase 1.
Gene Synonym:GFA, GFAT, GFPT, GFAT1, GFAT1m, GFPT1
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with GFPT1 qPCR primers for gene expression analysis, HP101111 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Glutamine:fructose-6-phosphate amidotransferase 1 (GFAT), also known as GFPT1, is a member of the N-terminal nucleophile aminotransferases and the first rate-limiting enzyme for the entry of glucose into the hexosamine biosynthesis pathway (HBP) in mammals. GFAT transfers the amino group from the L-glutamine amide to the D-fructose 6-phosphate, producing glutamic acid and glucosamine 6-phosphate. GFAT exists as a homotetramer in cytoplasm, and is proposed to be most likely involved in regulating the availability of precursors for N- and O-linked glycosylation of proteins. The full length of human GFAT contains 1 glutamine amidotransferase type-2 domain which catalyzes amide nitrogen transfer from glutamine to the appropriate substrate, and 2 SIS (Sugar Isomerase) domains found in many phosphosugar isomerases and phosphosugar binding proteins.Two isoforms of gfat have been identified: GFAT1 is predominantly expressed in skeletal muscle, whereas GFAT2 is expressed mainly in the central nervous system.

Size / Price
Catalog: HG11071-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry
Contact Us
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"