GFAP cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG12167-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GFAP Reagents
CRO Services
Product recommended

All GFAP Reagents
GFAP cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1299 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human glial fibrillary acidic protein with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Restriction Sites
HindIII + XbaI (6kb + 1.35kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
GFAP cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GFAP cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human 4E-BP1/EIF4EBP1 Gene Plasmid Map 5648
Human GFAP Gene Expression validated Image 16209
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
GFAP cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
ALXDRD cDNA ORF Clone, Human
GFAP Background Information

GFAP is a cell-specific marker which belongs to the intermediate filament family. It can distinguish astrocytes from other glial cells during development. GFAP is expressed in cells lacking fibronectin. It is a type III intermediate filaments protein which contains three domains: the head, rod and tail domains. GFAP functions in many important entral nervous system (CNS) processes, including cell communication and the functioning of the blood brain barrier. Improper GFAP regulation can cause multiple disorders. Defects in GFAP is related to Alexander disease which is a rare disorder of the central nervous system. It is a progressive leukoencephalopathy whose hallmark is the widespread accumulation of Rosenthal fibers which are cytoplasmic inclusions in astrocytes.

Full Name
glial fibrillary acidic protein
References
  • Buniatian G, et al., 1998, Biology of the cell. 90(1): 53-61.
  • Chen YS, et al., 2011, Experimental Cell Research. 317(16): 2252-66.
  • Isaacs A, et al., 1998, Genomics. 51(1): 152-4.
  • GFAP cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    GFAP cDNA ORF Clone in Cloning Vector, Mouse MG52126-G
    GFAP cDNA ORF Clone, Mouse, untagged MG52126-UT
    GFAP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52126-ACG
    GFAP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52126-ACGLN
    GFAP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52126-ANG
    GFAP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52126-ACR
    GFAP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52126-ANR
    GFAP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52126-CF
    GFAP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52126-NF
    GFAP cDNA ORF Clone, Mouse, C-His tag MG52126-CH
    GFAP cDNA ORF Clone, Mouse, N-His tag MG52126-NH
    GFAP cDNA ORF Clone, Mouse, C-HA tag MG52126-CY
    GFAP cDNA ORF Clone, Mouse, N-HA tag MG52126-NY
    GFAP cDNA ORF Clone, Mouse, C-Myc tag MG52126-CM
    GFAP cDNA ORF Clone, Mouse, N-Myc tag MG52126-NM
    GFAP qPCR Primer Pairs, Mouse MP201999

    GFAP cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GFAP cDNA ORF Clone in Cloning Vector, Human HG12167-G
    GFAP cDNA ORF Clone, Human, untagged HG12167-UT
    GFAP cDNA ORF Clone, Human, C-GFPSpark® tag HG12167-ACG
    GFAP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12167-ACGLN
    GFAP cDNA ORF Clone, Human, N-GFPSpark® tag HG12167-ANG
    GFAP cDNA ORF Clone, Human, C-OFPSpark® tag HG12167-ACR
    GFAP cDNA ORF Clone, Human, N-OFPSpark® tag HG12167-ANR
    GFAP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12167-CF
    GFAP cDNA ORF Clone, Human, C-His tag HG12167-CH
    GFAP cDNA ORF Clone, Human, N-His tag HG12167-NH
    GFAP cDNA ORF Clone, Human, C-HA tag HG12167-CY
    GFAP cDNA ORF Clone, Human, N-HA tag HG12167-NY
    GFAP cDNA ORF Clone, Human, C-Myc tag HG12167-CM
    GFAP cDNA ORF Clone, Human, N-Myc tag HG12167-NM
    GFAP qPCR Primer Pairs, Human HP101799
    info info
    添加购物车成功! 添加购物车失败!