Text Size:AAA

Human GFAP Gene ORF cDNA clone expression plasmid, C-GFPSpark tag

  • Human GFAP Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-tagged
  • Human GFAP natural ORF mammalian expression plasmid, C-GFPSpark tag
DatasheetReviewsRelated ProductsProtocols
Human GFAP cDNA Clone Product Information
NCBI RefSeq:BC013596
RefSeq ORF Size:1299bp
cDNA Description:Full length Clone DNA of Homo sapiens glial fibrillary acidic protein with C terminal GFPSpark tag.
Gene Synonym:FLJ42474, FLJ45472, GFAP
Species:Human
Vector:pCMV3-C-GFPSpark
Plasmid:pCMV3-GFAP-GFPSpark
Restriction Site:HindIII + XbaI (6kb + 2.03kb)
Tag Sequence:GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with GFAP qPCR primers for gene expression analysis, HP101799 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human GFAP Gene Plasmid Map
Human GFAP Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-tagged
Human GFAP Gene Expression validated Image
Human GFAP natural ORF mammalian expression plasmid, C-GFPSpark tag
[Click to enlarge image]
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.
GFPSpark Tag Info

GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.

Product nameProduct name
Background

GFAP is a cell-specific marker which belongs to the intermediate filament family. It can distinguish astrocytes from other glial cells during development. GFAP is expressed in cells lacking fibronectin. It is a type III intermediate filaments protein which contains three domains: the head, rod and tail domains. GFAP functions in many important entral nervous system (CNS) processes, including cell communication and the functioning of the blood brain barrier. Improper GFAP regulation can cause multiple disorders. Defects in GFAP is related to Alexander disease which is a rare disorder of the central nervous system. It is a progressive leukoencephalopathy whose hallmark is the widespread accumulation of Rosenthal fibers which are cytoplasmic inclusions in astrocytes.

References
  • Buniatian G, et al., 1998, Biology of the cell. 90(1): 53-61.
  • Chen YS, et al., 2011, Experimental Cell Research. 317(16): 2252-66.
  • Isaacs A, et al., 1998, Genomics. 51(1): 152-4.
  • Size / Price
    Catalog: HG12167-ACG
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"