GDPD1 cDNA ORF Clone, Human, C-His tag

Cat: HG13487-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GDPD1 Reagents
CRO Services
Product recommended

All GDPD1 Reagents
GDPD1 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
873 bp
Description
Full length Clone DNA of Human glycerophosphodiester phosphodiesterase domain con with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GDPD1 cDNA ORF Clone, Human, C-His tag Alternative Names
GDE4 cDNA ORF Clone, Human
GDPD1 Background Information
Full Name
glycerophosphodiester phosphodiesterase domain containing 1

GDPD1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GDPD1 cDNA ORF Clone in Cloning Vector, Mouse MG54377-U
GDPD1 cDNA ORF Clone, Mouse, untagged MG54377-UT
GDPD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54377-ACG
GDPD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54377-ACGLN
GDPD1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG54377-ANG
GDPD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG54377-ACR
GDPD1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG54377-ANR
GDPD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG54377-CF
GDPD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG54377-NF
GDPD1 cDNA ORF Clone, Mouse, C-His tag MG54377-CH
GDPD1 cDNA ORF Clone, Mouse, N-His tag MG54377-NH
GDPD1 cDNA ORF Clone, Mouse, C-HA tag MG54377-CY
GDPD1 cDNA ORF Clone, Mouse, N-HA tag MG54377-NY
GDPD1 cDNA ORF Clone, Mouse, C-Myc tag MG54377-CM
GDPD1 cDNA ORF Clone, Mouse, N-Myc tag MG54377-NM

GDPD1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GDPD1 cDNA ORF Clone in Cloning Vector, Human HG13487-G
GDPD1 cDNA ORF Clone, Human, untagged HG13487-UT
GDPD1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13487-ACGLN
GDPD1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13487-ACG
GDPD1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13487-ACR
GDPD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13487-CF
GDPD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13487-NF
GDPD1 cDNA ORF Clone, Human, N-His tag HG13487-NH
GDPD1 cDNA ORF Clone, Human, C-HA tag HG13487-CY
GDPD1 cDNA ORF Clone, Human, N-HA tag HG13487-NY
GDPD1 cDNA ORF Clone, Human, C-Myc tag HG13487-CM
GDPD1 cDNA ORF Clone, Human, N-Myc tag HG13487-NM
GDPD1 qPCR Primer Pairs, Human HP102187
info info
添加购物车成功! 添加购物车失败!