GDF15 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10936-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GDF15 Reagents
CRO Services
Product recommended

All GDF15 Reagents
GDF15 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
927 bp
Description
Full length Clone DNA of Human growth differentiation factor 15 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GDF15 cDNA ORF Clone, Human, N-Myc tag Alternative Names
GDF-15 cDNA ORF Clone, Human;MIC-1 cDNA ORF Clone, Human;MIC1 cDNA ORF Clone, Human;NAG-1 cDNA ORF Clone, Human;PDF cDNA ORF Clone, Human;PLAB cDNA ORF Clone, Human;PTGFB cDNA ORF Clone, Human
GDF15 Background Information

Growth-differentiation factor 15 (GDF15), also known as MIC-1, is a secreted member of the transforming growth factor (TGF)-β superfamily, as a novel antihypertrophic regulatory factor in the heart. GDF-15 / GDF15 is not expressed in the normal adult heart but is induced in response to conditions that promote hypertrophy and dilated cardiomyopathy and it is expressed highly in liver. GDF-15 / GDF15 has a role in regulating inflammatory and apoptotic pathways in injured tissues and during disease processes. GDF-15 / GDF15 is synthesized as precursor molecules that are processed at a dibasic cleavage site to release C-terminal domains containing a characteristic motif of 7 conserved cysteines in the mature protein. GDF-15 / GDF15 overexpression arising from an expanded erythroid compartment contributes to iron overload in thalassemia syndromes by inhibiting hepcidin expression.

Full Name
growth differentiation factor 15
References
  • Ago T, et al. (2006) GDF15, a cardioprotective TGF-beta superfamily protein. Circ Res. 98 (3): 294-297.
  • Hsiao E, et al. (2000) Characterization of growth-differentiation factor 15, a transforming growth factor beta superfamily member induced following liver injury. Mol Cell Biol. 20 (10): 3742-51.
  • Zimmers T, et al. (2005) Growth differentiation factor-15/macrophage inhibitory cytokine-1 induction after kidney and lung injury. Shock. 23 (6): 543-8.
  • GDF15 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    GDF15 cDNA ORF Clone in Cloning Vector, Rhesus CG90069-G
    GDF15 cDNA ORF Clone, Rhesus, untagged CG90069-UT
    GDF15 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90069-ACG
    GDF15 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90069-ACGLN
    GDF15 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90069-ACR
    GDF15 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90069-CF
    GDF15 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90069-NF
    GDF15 cDNA ORF Clone, Rhesus, C-His tag CG90069-CH
    GDF15 cDNA ORF Clone, Rhesus, N-His tag CG90069-NH
    GDF15 cDNA ORF Clone, Rhesus, C-HA tag CG90069-CY
    GDF15 cDNA ORF Clone, Rhesus, N-HA tag CG90069-NY
    GDF15 cDNA ORF Clone, Rhesus, C-Myc tag CG90069-CM
    GDF15 cDNA ORF Clone, Rhesus, N-Myc tag CG90069-NM

    GDF15 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    GDF15 cDNA ORF Clone in Cloning Vector, Canine DG70050-G
    GDF15 cDNA ORF Clone, Canine, untagged DG70050-UT
    GDF15 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70050-ACG
    GDF15 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70050-ACGLN
    GDF15 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70050-ACR
    GDF15 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70050-CF
    GDF15 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70050-NF
    GDF15 cDNA ORF Clone, Canine, C-His tag DG70050-CH
    GDF15 cDNA ORF Clone, Canine, N-His tag DG70050-NH
    GDF15 cDNA ORF Clone, Canine, C-HA tag DG70050-CY
    GDF15 cDNA ORF Clone, Canine, N-HA tag DG70050-NY
    GDF15 cDNA ORF Clone, Canine, C-Myc tag DG70050-CM
    GDF15 cDNA ORF Clone, Canine, N-Myc tag DG70050-NM

    GDF15 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GDF15 cDNA ORF Clone in Cloning Vector, Human HG10936-M
    GDF15 cDNA ORF Clone, Human, untagged HG10936-UT
    GDF15 cDNA ORF Clone, Human, C-GFPSpark® tag HG10936-ACG
    GDF15 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10936-ACGLN
    GDF15 cDNA ORF Clone, Human, C-OFPSpark® tag HG10936-ACR
    GDF15 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10936-CF
    GDF15 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10936-NF
    GDF15 cDNA ORF Clone, Human, C-His tag HG10936-CH
    GDF15 cDNA ORF Clone, Human, N-His tag HG10936-NH
    GDF15 cDNA ORF Clone, Human, C-HA tag HG10936-CY
    GDF15 cDNA ORF Clone, Human, N-HA tag HG10936-NY
    GDF15 cDNA ORF Clone, Human, C-Myc tag HG10936-CM
    GDF15 qPCR Primer Pairs, Human HP100815
    info info
    添加购物车成功! 添加购物车失败!