GCKR cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG15700-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GCKR Reagents
CRO Services
Product recommended

All GCKR Reagents
GCKR cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1878 bp
Description
Full length Clone DNA of Human glucokinase (hexokinase 4) regulator with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GCKR cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
FGQTL5 cDNA ORF Clone, Human;GKRP cDNA ORF Clone, Human
GCKR Background Information
Full Name
glucokinase (hexokinase 4) regulator

GCKR cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GCKR cDNA ORF Clone in Cloning Vector, Mouse MG5A3757-U
GCKR cDNA ORF Clone, Mouse, untagged MG5A3757-UT
GCKR Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3757-ACGLN
GCKR cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3757-ACG
GCKR cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A3757-ANG
GCKR cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A3757-ACR
GCKR cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A3757-ANR
GCKR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A3757-CF
GCKR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A3757-NF
GCKR cDNA ORF Clone, Mouse, C-His tag MG5A3757-CH
GCKR cDNA ORF Clone, Mouse, N-His tag MG5A3757-NH
GCKR cDNA ORF Clone, Mouse, C-HA tag MG5A3757-CY
GCKR cDNA ORF Clone, Mouse, N-HA tag MG5A3757-NY
GCKR cDNA ORF Clone, Mouse, C-Myc tag MG5A3757-CM
GCKR cDNA ORF Clone, Mouse, N-Myc tag MG5A3757-NM

GCKR cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GCKR cDNA ORF Clone in Cloning Vector, Human HG15700-G
GCKR cDNA ORF Clone, Human, untagged HG15700-UT
GCKR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15700-ACGLN
GCKR cDNA ORF Clone, Human, C-GFPSpark® tag HG15700-ACG
GCKR cDNA ORF Clone, Human, N-GFPSpark® tag HG15700-ANG
GCKR cDNA ORF Clone, Human, C-OFPSpark® tag HG15700-ACR
GCKR cDNA ORF Clone, Human, N-OFPSpark® tag HG15700-ANR
GCKR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15700-NF
GCKR cDNA ORF Clone, Human, C-His tag HG15700-CH
GCKR cDNA ORF Clone, Human, N-His tag HG15700-NH
GCKR cDNA ORF Clone, Human, C-HA tag HG15700-CY
GCKR cDNA ORF Clone, Human, N-HA tag HG15700-NY
GCKR cDNA ORF Clone, Human, C-Myc tag HG15700-CM
GCKR cDNA ORF Clone, Human, N-Myc tag HG15700-NM
GCKR qPCR Primer Pairs, Human HP104294
info info
添加购物车成功! 添加购物车失败!