GCDH cDNA ORF Clone, Human, C-HA tag

Cat: HG14093-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All GCDH Reagents
CRO Services
Product recommended

All GCDH Reagents
GCDH cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1317 bp
Description
Full length Clone DNA of Human glutaryl-CoA dehydrogenase with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GCDH cDNA ORF Clone, Human, C-HA tag Alternative Names
ACAD5 cDNA ORF Clone, Human;GCD cDNA ORF Clone, Human
GCDH Background Information
Full Name
glutaryl-CoA dehydrogenase

GCDH cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GCDH cDNA ORF Clone in Cloning Vector, Rat RG81419-G

GCDH cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GCDH cDNA ORF Clone in Cloning Vector, Mouse MG59096-U
GCDH cDNA ORF Clone, Mouse, untagged MG59096-UT
GCDH Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59096-ACGLN
GCDH cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59096-ACG
GCDH cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59096-ANG
GCDH cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59096-ACR
GCDH cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59096-ANR
GCDH cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59096-CF
GCDH cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59096-NF
GCDH cDNA ORF Clone, Mouse, C-His tag MG59096-CH
GCDH cDNA ORF Clone, Mouse, N-His tag MG59096-NH
GCDH cDNA ORF Clone, Mouse, C-HA tag MG59096-CY
GCDH cDNA ORF Clone, Mouse, N-HA tag MG59096-NY
GCDH cDNA ORF Clone, Mouse, C-Myc tag MG59096-CM
GCDH cDNA ORF Clone, Mouse, N-Myc tag MG59096-NM

GCDH cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GCDH cDNA ORF Clone in Cloning Vector, Human HG14093-G
GCDH cDNA ORF Clone, Human, untagged HG14093-UT
GCDH cDNA ORF Clone, Human, C-GFPSpark® tag HG14093-ACG
GCDH Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14093-ACGLN
GCDH cDNA ORF Clone, Human, N-GFPSpark® tag HG14093-ANG
GCDH cDNA ORF Clone, Human, C-OFPSpark® tag HG14093-ACR
GCDH cDNA ORF Clone, Human, N-OFPSpark® tag HG14093-ANR
GCDH cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14093-CF
GCDH cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14093-NF
GCDH cDNA ORF Clone, Human, C-His tag HG14093-CH
GCDH cDNA ORF Clone, Human, N-His tag HG14093-NH
GCDH cDNA ORF Clone, Human, N-HA tag HG14093-NY
GCDH cDNA ORF Clone, Human, C-Myc tag HG14093-CM
GCDH cDNA ORF Clone, Human, N-Myc tag HG14093-NM
GCDH qPCR Primer Pairs, Human HP102746
info info
添加购物车成功! 添加购物车失败!