GATM cDNA ORF Clone, Human, untagged

Cat: HG14456-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GATM Reagents
CRO Services
Product recommended

All GATM Reagents
GATM cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1272 bp
Description
Full length Clone DNA of Human glycine amidinotransferase (L-arginine:glycine amidinotransferase).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GATM cDNA ORF Clone, Human, untagged Alternative Names
AGAT cDNA ORF Clone, Human;AT cDNA ORF Clone, Human;CCDS3 cDNA ORF Clone, Human
GATM Background Information
Full Name
glycine amidinotransferase (L-arginine:glycine amidinotransferase)

GATM cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GATM cDNA ORF Clone in Cloning Vector, Rat RG81365-G

GATM cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GATM cDNA ORF Clone in Cloning Vector, Mouse MG53105-G
GATM cDNA ORF Clone, Mouse, untagged MG53105-UT
GATM cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53105-ACG
GATM Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53105-ACGLN
GATM cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53105-ANG
GATM cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53105-ACR
GATM cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53105-ANR
GATM cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53105-CF
GATM cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53105-NF
GATM cDNA ORF Clone, Mouse, C-His tag MG53105-CH
GATM cDNA ORF Clone, Mouse, N-His tag MG53105-NH
GATM cDNA ORF Clone, Mouse, C-HA tag MG53105-CY
GATM cDNA ORF Clone, Mouse, N-HA tag MG53105-NY
GATM cDNA ORF Clone, Mouse, C-Myc tag MG53105-CM
GATM cDNA ORF Clone, Mouse, N-Myc tag MG53105-NM

GATM cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GATM cDNA ORF Clone in Cloning Vector, Human HG14456-G
GATM Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14456-ACGLN
GATM cDNA ORF Clone, Human, C-GFPSpark® tag HG14456-ACG
GATM cDNA ORF Clone, Human, N-GFPSpark® tag HG14456-ANG
GATM cDNA ORF Clone, Human, C-OFPSpark® tag HG14456-ACR
GATM cDNA ORF Clone, Human, N-OFPSpark® tag HG14456-ANR
GATM cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14456-CF
GATM cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14456-NF
GATM cDNA ORF Clone, Human, C-His tag HG14456-CH
GATM cDNA ORF Clone, Human, N-His tag HG14456-NH
GATM cDNA ORF Clone, Human, C-HA tag HG14456-CY
GATM cDNA ORF Clone, Human, N-HA tag HG14456-NY
GATM cDNA ORF Clone, Human, C-Myc tag HG14456-CM
GATM cDNA ORF Clone, Human, N-Myc tag HG14456-NM
GATM qPCR Primer Pairs, Human HP103104
info info
添加购物车成功! 添加购物车失败!