GALT cDNA ORF Clone, Human, N-HA tag

Cat: HG14112-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GALT Reagents
CRO Services
Product recommended

All GALT Reagents
GALT cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1140 bp
Description
Full length Clone DNA of Human gAlActose-1-phosphate uridylyltransferase with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GALT Background Information
Full Name
galactose-1-phosphate uridylyltransferase

GALT cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GALT cDNA ORF Clone in Cloning Vector, Rat RG81288-U
GALT cDNA ORF Clone, Rat, untagged RG81288-UT
GALT Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81288-ACGLN
GALT cDNA ORF Clone, Rat, C-GFPSpark® tag RG81288-ACG
GALT cDNA ORF Clone, Rat, C-OFPSpark® tag RG81288-ACR
GALT cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81288-CF
GALT cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81288-NF
GALT cDNA ORF Clone, Rat, C-His tag RG81288-CH
GALT cDNA ORF Clone, Rat, N-His tag RG81288-NH
GALT cDNA ORF Clone, Rat, C-HA tag RG81288-CY
GALT cDNA ORF Clone, Rat, N-HA tag RG81288-NY
GALT cDNA ORF Clone, Rat, C-Myc tag RG81288-CM
GALT cDNA ORF Clone, Rat, N-Myc tag RG81288-NM
GALT qPCR Primer Pairs, Rat RP301244

GALT cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GALT cDNA ORF Clone in Cloning Vector, Human HG14112-G
GALT cDNA ORF Clone, Human, untagged HG14112-UT
GALT cDNA ORF Clone, Human, C-GFPSpark® tag HG14112-ACG
GALT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14112-ACGLN
GALT cDNA ORF Clone, Human, C-OFPSpark® tag HG14112-ACR
GALT cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14112-CF
GALT cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14112-NF
GALT cDNA ORF Clone, Human, C-His tag HG14112-CH
GALT cDNA ORF Clone, Human, N-His tag HG14112-NH
GALT cDNA ORF Clone, Human, C-HA tag HG14112-CY
GALT cDNA ORF Clone, Human, C-Myc tag HG14112-CM
GALT cDNA ORF Clone, Human, N-Myc tag HG14112-NM
GALT qPCR Primer Pairs, Human HP102765
info info
添加购物车成功! 添加购物车失败!